Overview
NameMedtr8g494210
Unique NameMedtr8g494210
Typegene
OrganismMedicago truncatula (Barrel Medic)
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
chr8chromosomechr8:39416695..39425898 +
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
Medtr8g494210.1Medtr8g494210.1Medicago truncatulamRNA
Medtr8g494210.2Medtr8g494210.2Medicago truncatulamRNA


Sequences
The following sequences are available for this feature:

gene from alignment at chr8:39416695..39425898+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>Medtr8g494210 ID=Medtr8g494210|Name=Medtr8g494210|organism=Medicago truncatula|type=gene|length=9204bp|location=Sequence derived from alignment at chr8:39416695..39425898+ (Medicago truncatula)
TAGAAGAATTTGATCAATAAGTGTTCGCCTACAAAAATATAAAAAAAGAA TTTGAACAAGTTTGATTGATTGATTATCCGTGTTGGCAAATTCTCCGAGA AGACAAAGGGAGAAGAAGCCTCAACACCTCATCCTCACCGCATGCTCTCT CAACTCTAACACACCCGATCCCATTCTCCTTCACCTTCTTCATTCCCCCT TTCAATTTCCTCAATTCCATCGCAAAATCCCTAACCTCCACCATGAACGA TTTCGATAATCTTCTATCTTCTTCCGATTTCGGTATCAAACCTCAAGGTA AATCCGCTCCAATGTCTCAACCACCTAAATCATCATCTTCAAATTCAAAT TCAACTTCTCTCAACTTCGATTTTGGATCCCGATCCGCTCGTACATCCGA TTCCGTTTTCGGATCCTCCACCCACCGTCACAACCGCGACTCCTCCAGTT TCGACGATCTCTTCACCACCACCACCGGATCCAACTCTAAATCCAATCCT CGCGATGCACCCTTCGATTTGGATTCCATGTTTCCTGGATCCGCCGGAAA TTCTTCACCGCCACCGGTTTATGATAAACCGGTTTACGACGACGATGTTT TTGACGGTGTGCCTGGGCTGAAGAGCACCGGGAAAGTTAATTTTGAAAAC GTTTTCGCATCCCCGAAATCGGATAGTGGTGCATTTGATGATCTTCTTGG TGGATTTGGCAAGGATTCGAAGGGTTCTGGTAGGAAAGGTTTGGAGAAAA ATGATAGAAGTGGTTCTGATTTTGATGATTTGTTAGCTGGATTTGGAAAG AGTAAATCATCGTCTAGTGACAGGTATATTTTATAGTATATATTAGTATA TTTTTAGCAGTGTATTTTGTTGTTTTGGTAACTTAGATTCTTTTGTAATA ATTGTGATTACTCAGTAGTACTTTTCGTGATTATGCTTTTTGTGCAAGCA AGAATATACATGTTTCTGAAGTTTTTTTCCTGAATATATGGTAGTCAATT ACTCAATTATGCATTGTAGTTGTCGTATTCTATTTCGATATATTTCGAGC ATCGTTGTATTGCAAACTGTTGGTTTGGGAGTGAAGATTCAATTTTTTTA TTTTTCTCTCTAGGAGGTTTTTAATGCATATCATGTATTAGGTCTTTGAA ATGCATTTGGATGTCCTGTGCATTTTGTAATTACAATCATAAGTTATTGT TCATGTGATATCAGCCTCTGAAGTAATCAATGTGATAGATATTAAGGTTT TGTTTGCGAGTTTGGAGGGGTGGGCATTGAAAAAAAAAGGAGCAAGTGGA AGTAATAGAGGACTTTGGAATGGGAGAACTTTGGGCTGTCTATTTTTCTT CATAATTCAAAATTCCCTTAATTTGGAGGAACTCAAAAATTGTATTAGAG GAGGGTTTTGGTCTTTTGGAGGGTTTATATCAAATCTTTAAATTCAATCT ATTTATAATATTTTCAAAATAAAAAATATATATTAATCATAAACATTCAT TTATCATTCCCTACAAAAACACCCTTTCAATAAATGTGGAAGATTTCTCT ATTTTTCTTCTATCCCCCTTCCCTCCCCTCCAAACTCGCAAACAGAGCCT AAGTAGCACATTTGAAAGATAAGTTTTAGTAACATTGGTTATAGTTTTCT ATTGTGTTGACAATTGAACAAAGCTCAAGGAGTTTGGTAGGTACTAGTTA ACCCTGAATATTGAGGTAATAGTGTTCATTGATTGAAAATCTGTATTGCA ACTAATGTATTCGAGAGACTTGGACTTTTCCCCTAACCATATTTTTTTCC AGAAAGACCTCCTCTTGCTATCTTTTATTGCTTCCTATTTATTCTCTTGT CTACTACTATAATTTTTCTATCTTTCAGTGCACTTTGTGATTTAAAAAGA GTAAGAAATGCAATCAAATCTCGAGACTTAATTAGTTTGAGAGTTTGAGA ATGTCTCACACCCTATGCAAATTAAGTTTAGCATTTTCGTTTCCAGCTCA GGGTGGTTGTATTCACATCAGACGTACCTTTATTCTTATGTTGGGTAATG AATTTTATTTGTTGAGTGTTTCTCTTTCTATAATGTGAATTATTCATTTG GTTTGGTTGCTGATGCATACAAGGACTACCGCGAAGAAAGAAATTTATCT TTGTCTGAGGATGCTTCATCCATTAGGTGCTAGAAATTGAAAATCTTACA ATCGTGTTGTCCCTAAGTATTTCATTTAGGTAGACAGGAAACAGGAGTAT GTGAATAGAGGAATAGGAACCAAACCCCATATTATTACAACAACATTTTC CTGCTATCATCTTTAACTTGTTCTCTTTTTAAAACATTTTGTTTTCCATG AATAAAATAGTAAATGGAAAAAGAAGTGAGAAATCTTTGTTTCAAGCTGT GAACACCCTCTTTTTTTTTTTTTTTTTTTTTTTAAAATCTAATTACCACA TATATTTATCGCACTCACACATAAATAAATGGAATAAACAACAAGATAAT TTTCCATGTTATCTTTGATGAGCACTTCATAGATATTGTTTATCTCGCCA ATGTTGGATGTGTCGTAATCATTTTTATATGTTTATAACAGGCGTGCTCC TGATATTGGTTTGTCCTCTGACCCAACTGTAAGTGCATCTAAAACAACCT CCATCGAAGCAGAAGACCCATTCAAAGTATTTTCATCAACTTCAGCCCCA ATGGATTCATCCAGAAGCAACTTCACAGACCCTTTGGAAGAAATTAGTAA ATTTAGTAGTTCTAGAAGCACTAAAAATAATAGTTCATCAACTTCAAATG GTAGAATATATGAAGACATTGACCCTTTTGATGGGCTCGGACGATCTGTA CCGGCATTCTCATCTGAGAGAAATAGCAGCAAGGATAACAGTGCTCCAGG GTTGAACACAAGCACAAGTTGGACTGGAGATAAAGAACCAGTTGATAAGT TTTCTGGGATGAGTCCTGAGAGGCACTCACAAAAGGACATTCCCGTTGAA AGTGATCAGGATTTTCTGCAGCCCCCATTTTACACGCCTACCTTTTCATC TGATTCTAATAAACCAGTTGGCCAAAGGTCTACTTCGCCTCCAAATAATA ATAGTGGTTTTGGCCAAGCCAATATTCCGGCAGATATGTCTCCAAAATAT GAAGAAAACTTGGAATCATGTGAGGATGTATGGCTGACTGTGTCAGAGAT TCCTCTTTTTACACAACCAACCACTGCTCCACCGCCTTCAAGACCCCCTC CTCCACGGCCAGTGAATATTCCCAGGTCAGGAACAGGTTCACCGGCTTCT ACCAACACTAGAAAGAAGGCCAATGAATTTTCTTCTTTCCCGGGTTCCAC TCGATTCTCTCATGACCCTAGGTCTGCTACAGCTGCAGCATCGGCATCTC CAACATCTCAGTTTGATGAACTTGATGATTTTGCTGCAGGCAGCAGTCAC AGTAATGATGCTGAGAGTGGAAATGGTCTTCCCGATGATGAGTTAGAGAT GAACACGGCTGCTGCGGCCATGAAGGAAGCAATGGATAGGGCTGAGGCTA AATTTAGGCATGCAAAGGAAGTTAGGGAGAGAGAGCATACAAAGGCTGCT AAAAGCAAAGAATTTGGGCAATCGGAAAAAGATGACAGAGCTATACCAGA GGAGAGAGAAAAACAAGAAAGGTTAGAACGTGACCGGCAGCAAAAAGAGA GAGAGGAAAAGGAGCAAAGAAGATTAATGAAAGAAAGGGAGGAGAGAGAA AAGGCTAGACAGGCCGTAGAAAGAGCCACACGAGAAGCTCGTGAACGAGC AGCTGCTGAAGCACGCCAGAGAGCTGAGAGGGCTGCTGTTGGGAAAGCTA ATGCTGAAGCCCGAGAGCGTGCTGAAAGAGCTGCAGTACAAAGGGCACAT GCTGAAGCCCGAGAAAGGGCAGCTGCAGAAGCAAAGGAAAGAGCTGAAAA GGCTGCTGCAGCGGCAAAGGAGAGGGAAGCACGGGAAAGAGCTACAGCTG CGAGGGCTGAAACTGAAGCACGGGTTAAAGCTGAACGTGCCGCAGAAAGG GCTGCTGCCGAGGCCAGAGAGAGGGCTGCAGCTTCTGCAAGGATGAACCA ACAGAAGAATGGGGATGATCTTGAATCCTTCTTTGGCGCGGGTTCAAGAC CCAGCAGTGCTCCAAGGCCTTTTAGGGACTACTCCACAGTGAGGATCTCT TTTTCATTTTTCTTTAAATGTGTAGTCTATATTCAAATATAATGGCCAAA CTTGGGTTTGTTGTCTTCCCATCTTTCAACAATAATCCTAAACAGACAGA AAATATAGTTAGAGGGTAGTTGTACCTTTTCTATTTCTATTATAAATAAA GCAACTTTATTTTTTATAAGATGACAAGTAAATAATATGTAGTTATGTAA AAAATTTAAATCATCTGATTTAAATTAAAATTAAAATAAAAAGGAAGGTT AAAAACCATGTCCACTCTTATTTAATCTATATTCAAAACTTGTTGTTAAG TGTCGGAACCTGTATGTTTTCAGGAGGCAGATGCAACAAGGAAAAGTGGA TCTTCAAATATGAAAAAAGCACCATCATCAAGTAATATTGTTGATGATCT TACCTCAATCTTTGGAGGTAGGTTTGCATTTTTAATGTGTTATTGATGCA ATAGTAGTTTGATTTTGTTAAGACTTGCAATGTTGAAATAGAGAAAGATA AGAAAGATTCTAAGAGCAGAGAACAGAAAGATCCAGGATGATTGCAATAG TTAGTATTATGGGAAGAGTCAAGGAAAGTACACATACAACAAATCTATAT ATATATATATATAGGATTCAGATCCTCGTAAGTGTAAAGTGAGAAAATCA AAGGTTGTTATTTTAACAAACTCATGATTTGTTATGGTGTACTTCTAATA TCTACCTTTGATTTGTTAATCAATGGTTGATATTACTCACTTTATACTTT AAAGTGGATTGCTCACTTTAGAGGAGCCAGATCCACATATCTAATGTGTT TTTTAATTTTAAAAAATAAAACATCTCTCTGTTTTTGTCGTTGCTTACTG CTGGGCCTTCTATTAAGGTGGAGGGGACAAATAATAGAATGGAGTGGGGA GGATGGGTAACCTTTAAGACATGAAAAGGCTAGCAAATCTTGGGACGAAA AGCTGAGAGTAGATATGGGTCCTTCTCAGTACAGGAGCCTTTTCTTTTAT GCTCATCGCCATTTTTCCTATTTTCTGGAGCATGGATCTATTCCACCAGC CAAGCATAGATAAAAGATATACGCGCTTCTCCTTCATAAAAGAGCTAAAA GGCCATTTCTAATTCTGCTTCTTTTCCTATTCCTATCTCAATACAGTTTA GATATCCATACTGTGACAGAGGCTTCCTTCCCTGGAATTTAGTGGCTAAT TTGATAAAATACTACACAATTTTACAGTTTCCTAAGTTCAATTCACTTTC TATCACTTAGATGGCTTATTTTGTTCGCTCTCTCTCTCTCTCTCTTTTAT GGTTTGAAGCTGCTCCATCATCTGGAGAGTTTCAAGAAGTTGAAGGGGAA AGTGAAGAAAGGCGAAAAGCTAGGTTGGAACGCCACCAGAGGTCTCAGGA GCGTGTGGTATGTGTTATTGCATCACTGCATCTGTCTCCTTAATTTATTT TCTTTGTTGTTTCTTGACAGTTGATACAAAGAACTGGTGAAAAATACACT TTTTTTAACCAACTTGTTTATGCTATGACCATGATATTTTGTACTAGGCA AAAGCATTGGCTGAGAAGAATCAGCGGGACTTGCAAACTCAAAGAGAGCA AGCTGAGAGAAGTGTAAGTAGTGTTGTTTTTCTTTCTATTTATGGGTGAG GGTTTTTTTTGTTAGTACAATAACTGCATTTACAATACCAATCCCTTCTT CATCCTTGTTCTAGGCAAAAACTGTTTGTAGAAGCTGCCGATAAAATTTT GCAATTTTTATTGTAATATGGTTTTGTTCTTGTTATTTAATTTGTTTTTT CTGTGAATTGATTTCAGAGGCTTGGTGAAACACTGGATTTTGAAATTAAG CGGTGGTCTGCAGGAAAAGAGGGAAACTTACGAGCTTTGCTCTCCACCTT GCAATATGTATGTACTTAGTAAGAGCACAGAATAATATCTCTGAATGTTT CCTATTCCAGATCCGTATAGCACATGCATGGCAGTATGTAGGCATGGATC ATGTCTTTTTTTTTTTTTTACGTTTTCAATTCTTGGGTCCAAATTTTAAC ATATGCTATACTGGAATTGTTATATTGTCAGACATACTTTCTCATGTGTC TTGTCTGATTGTCAATTCACCTTCTAGGGCTAGAAGTGAATGGTTGTGGT CGCTTTAAAACTGTCCTGGTTGTATAGATCTAGGACTGAGTTTCTCTGTT TACTAAAGGTGCAACTAACATGTCTATTTCCTGCAAAAGATATCATTGAT TGTTGCAATTTCTGATCAGATATTAGCCTACAGAAAACCACGTCCTTATG AGAGAGGTTTGTTTGATTTTGAAAAGAATGTAAATGATGTGGTCATAATT CAATTTCAGTCAATTCAGGGGAAGGTGAGACTCGAAGCAACTTGTTTTCA TAATTTTATGCCGTGGATTCTACGGTGGGCCGCATAACATATCGTCCACA GATGGACACTCAAGTTTACTGCCTAGCCTACAATAGGTTTCTCAATATGG AAAATTCAGTACTTCCTTATATAAGATACTTGCATTTGTATGGTGAGGTA TTTAAGAATTAAATATTGCAAGTAAGGAGATGCACTCCCTAAATTGAATT GGTGTGGGAACTGTGAAGGGTGAATATCATTTCCCCTTTTCGCTCACCAT GCCCAACCTGTGAGTGGGTACGGAAACGACGATTGAAGTGTCATCAACCT GGGCATAATTTTTGTCATTTGCCAGTTTTTGTTTAGATTGCAGAATTGAG AATTTTCATCTAGAGAGGGATTTTACTTTTCATTGTGGAGAGAGAATTGA AGGTAGTAGTATCAAAGGGATTTTTTTGGTGGTCCCCACCCCATGTGCAC ACACTTCCTTTGGTTTTGGAGGTATCAGAGTCGCCTGGATCTTTGTTGTT GTACCTGGAACACACGTCGAGACCTTCCACATTGCATGCTTCGAGCGGCT CCTTGTGCGCCACCTCTGGAGATTTCCCTTTTGAGGCACGCTCTGATAAA TGGTCAAAAAACCTTAGGGTGAAGGCTTCAGGAGAAACAAAAGGACCTAT GGCACAATTGCCATAAATTCTCAACATCCAAGTTACCAGGCAGAGATCTT AATCATTGAATAAAGAATAAAATAGCAATATATGCATAACATATTACAAG TGGTCTAGTGTTGGACCGTATTCTTCGTGGTCCACATAGACAGTCTTCCT TATGCACTCTAAAAGGTTCATGCATTTGAATTTTGAATGAGCCAAAACAG TGCCTTTGTTTGTGTATTTAAGGTGTTATTGTTTTTGTTACAGAATTAGC GTGAACTAGTTTTTGACCAGAGAATCTGTCAATGATGTTAACTTGTTTCA TTCATGAATGATTATCAGGTGCTGTGGCCTGAATGTGGTTGGCAGCCAGT CGGTTTAACTGATTTGATTACAGCTGCTGCTGTTAAGAAGGCTTATAGGA AAGCTACGTTGTGTATTCATCCAGATAAAGTACAGCAGAAGGGTGCCACT CTTCAGCAAAAATATATTGCAGAAAAGGTGTTTGACCTACTCAAGGTATT TCTGACCATCTTATGTTCTTTATAATCAAGAAATTTATTAAAAAAATTAT GGTAGGGGTTTACTGTGATGTGCTGCCTTCACAGATTGTCAGTTTATTTG TTGCTTGGTTTCGTTTTGATTCTTAAACTTTGGGGTTTTCACACTCTGAT CGTGAGGGCTCACATATTTCCTCATCTCAATCCATATTTTTCTTTCAGTC TTACCGCTTGTTTGGTTTTAAGAAACATTTTCTATTATCATTTTTTATTA CAAAAATGTCAACTTATTTTCACTTTTTACTGTCTTCAAAGTTTTGTATA AAAACAGTGAGAACAAAATTGTGTTGTTTTCATTGTTTCCTAAACAAAGA TTTCATTGTGGCCTATTTACTTGAACATTTTCAGTTTCAATACTTAAATA CCAGGGCCTATTTACTTGCCATATTTTCCGTTATCATTTTCATATCATCT AATAAACATAAGAGAGTATAGATCCAATATTCCCCTCACCATTTCCTTTT ATAATTTTTGAAAACATACATCCACAAAAATAAACAATTCTTCCTAGCTG CCTTCATCCTTTCTTTATCATAATTGTTCATTACACGAGTTCCATTTCCT TATTAGCAATTTAAAATATACAAATTTTAGAAAATGAAAACTGAAAATGA TTTTAAAAAGTAAACAAGCCCCTAATTCTCCTATTTCTTTTTCATAAAAA TGTTTTAATGGCGACATGAATATTTGTCAAGAGTCTAGTATAATACTATA ATATAGCCAAGTCTAGAATACTCTGCTTTCACTATTTGCTGAAAGGTTTA TAATTTTTTTTATAACAGGAAGCGTGGAATAAATTCAATTCTGAGGAGCT GTTTTAATCTTTGATGGATTAATATATACTTCAAGATAATTTGTTGGACA GTTCTATTCAGAGGAGAGACCACAGCCCTGTTTCTGCTGCCTCCCCGATT GCATAATTGTTTTGATTGAAGTTATGATGCATTGTTGGTAACATATTGCT TCCCTGTCTGGCTTTCTCGGTTGTCATTGATGTTCTTCTCGGGGTTGTTG TGTTTCTACATGTTCTATAAATGTAGCATGTTTTGTTGATGTAAAATGTT TTTTGTGCTATCAATTTTATTATTCATTATCCTTGTCTAGTGAGGGCTCA CAAGCCGACAAGCGATCCCTTTTCTTTTTCTTTTCTTAATTTTGGTTCAA GAGAGGGTCCACCACGATGTGGTCATGGGATGCCCTTCTTTTCGACCTGT GATATATTATTATAGCGCGATGTCTTGAATATATACCATCTTGTTGTGGA TTTACATCAAAAACTGAGAATTATACATGAATATTTATTTTCAAGTTTCT GTATTTTATTCATTAGAAATCAGTGTTGTCAATTAGTGGAATGTGAATAA ACCATTATTGTTCTGTTATGTACGTGATTTACACAAATTCTCATCAAGTG GAGG
back to top
Properties
Property NameValue
Noteauxilin-like protein