Overview
NameMedtr0058s0010.1
Unique NameMedtr0058s0010.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length189
Homology
BLAST of Medtr0058s0010.1 vs. NCBI nr
Match: gi|302143276|emb|CBI21837.3| (unnamed protein product [Vitis vinifera])
BLAST of Medtr0058s0010.1 vs. NCBI nr
Match: gi|21618268|gb|AAM67318.1| (unknown [Arabidopsis thaliana] >gi|62320190|dbj|BAD94411.1| hypothetical protein [Arabidopsis thaliana])
BLAST of Medtr0058s0010.1 vs. NCBI nr
Match: gi|297836836|ref|XP_002886300.1| (hypothetical protein ARALYDRAFT_900440 [Arabidopsis lyrata subsp. lyrata] >gi|297332140|gb|EFH62559.1| hypothetical protein ARALYDRAFT_900440 [Arabidopsis lyrata subsp. lyrata])
BLAST of Medtr0058s0010.1 vs. NCBI nr
Match: gi|118485249|gb|ABK94484.1| (unknown [Populus trichocarpa] >gi|118488375|gb|ABK96005.1| unknown [Populus trichocarpa])
The following BLAST results are available for this feature:
BLAST of Medtr0058s0010.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 4
Match NameE-valueIdentityDescription
gi|302143276|emb|CBI21837.3|8.294360e-645.65unnamed protein product [Vitis vinifera][more]
gi|21618268|gb|AAM67318.1|2.234130e-557.89unknown [Arabidopsis thaliana] >gi|62320190|dbj|BA... [more]
gi|297836836|ref|XP_002886300.1|8.253370e-555.26hypothetical protein ARALYDRAFT_900440 [Arabidopsi... [more]
gi|118485249|gb|ABK94484.1|2.639090e-448.94unknown [Populus trichocarpa] >gi|118488375|gb|ABK... [more]
back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
BlastP Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0058s0010.1 ID=Medtr0058s0010.1|Name=Medtr0058s0010.1|organism=Medicago truncatula|type=mRNA|length=189bp
ATGGCAGTAAGTCTCAAATCGATCCAGGACAACACAGGGACAAAATTGGC
CGATTTTTCAAAATTCAAGGACGAATTTGAGGTGAAGTACAGAGCCAAGG
AGGTGGAGAGATTTTTCAAGAAGGGAATCCATACTGTTGGAAATTCATTC
AAGAAAGGATGGAACAAAATCAAGCATCTCAAACGCTAG
back to top