Overview
NameMedtr0057s0200.1
Unique NameMedtr0057s0200.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length180
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF02902.1478912-787631-50163-20522.54.8e-0922.65.9e-05

Homology
BLAST of Medtr0057s0200.1 vs. NCBI nr
Match: gi|356540478|ref|XP_003538716.1| (PREDICTED: uncharacterized protein LOC100798851 [Glycine max])
BLAST of Medtr0057s0200.1 vs. NCBI nr
Match: gi|356495639|ref|XP_003516682.1| (PREDICTED: uncharacterized protein LOC100807274 isoform X1 [Glycine max])
BLAST of Medtr0057s0200.1 vs. NCBI nr
Match: gi|502165347|ref|XP_004513537.1| (PREDICTED: uncharacterized protein LOC101492952 [Cicer arietinum])
BLAST of Medtr0057s0200.1 vs. NCBI nr
Match: gi|356551420|ref|XP_003544073.1| (PREDICTED: light-mediated development protein DET1-like [Glycine max])
BLAST of Medtr0057s0200.1 vs. NCBI nr
Match: gi|254971801|gb|ACT98136.1| (TNP1 [Glycine max])
BLAST of Medtr0057s0200.1 vs. NCBI nr
Match: gi|502082401|ref|XP_004487155.1| (PREDICTED: uncharacterized protein LOC101499726 isoform X1 [Cicer arietinum])
BLAST of Medtr0057s0200.1 vs. NCBI nr
Match: gi|356562060|ref|XP_003549293.1| (PREDICTED: uncharacterized protein LOC100800180 [Glycine max])
BLAST of Medtr0057s0200.1 vs. NCBI nr
Match: gi|356514621|ref|XP_003526004.1| (PREDICTED: uncharacterized protein LOC100817556 [Glycine max])
BLAST of Medtr0057s0200.1 vs. NCBI nr
Match: gi|356561301|ref|XP_003548921.1| (PREDICTED: uncharacterized protein LOC100781264 [Glycine max])
BLAST of Medtr0057s0200.1 vs. NCBI nr
Match: gi|356577219|ref|XP_003556725.1| (PREDICTED: uncharacterized protein LOC100801896 [Glycine max])
The following BLAST results are available for this feature:
BLAST of Medtr0057s0200.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 10
Match NameE-valueIdentityDescription
gi|356540478|ref|XP_003538716.1|2.363330e-939.66PREDICTED: uncharacterized protein LOC100798851 [G... [more]
gi|356495639|ref|XP_003516682.1|4.449410e-937.93PREDICTED: uncharacterized protein LOC100807274 is... [more]
gi|502165347|ref|XP_004513537.1|1.501820e-636.96PREDICTED: uncharacterized protein LOC101492952 [C... [more]
gi|356551420|ref|XP_003544073.1|2.249320e-538.98PREDICTED: light-mediated development protein DET1... [more]
gi|254971801|gb|ACT98136.1|3.512680e-539.66TNP1 [Glycine max][more]
gi|502082401|ref|XP_004487155.1|4.678940e-536.36PREDICTED: uncharacterized protein LOC101499726 is... [more]
gi|356562060|ref|XP_003549293.1|8.565790e-542.59PREDICTED: uncharacterized protein LOC100800180 [G... [more]
gi|356514621|ref|XP_003526004.1|1.266830e-444.00PREDICTED: uncharacterized protein LOC100817556 [G... [more]
gi|356561301|ref|XP_003548921.1|1.982160e-437.50PREDICTED: uncharacterized protein LOC100781264 [G... [more]
gi|356577219|ref|XP_003556725.1|2.558100e-438.89PREDICTED: uncharacterized protein LOC100801896 [G... [more]
back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableSUPERFAMILY54001Cysteine proteinasescoord: 1..59
score: 3.3

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0057s0200.1 ID=Medtr0057s0200.1|Name=Medtr0057s0200.1|organism=Medicago truncatula|type=mRNA|length=180bp
CAACCTAATGGCAATGATTGTGGATACTATGTGATGAAGAATATGTTAGA
TATCATCTCTGCTAATATTACTAAGTCTTGGATGGAGGTATTCAATGATC
CAACGGCATTAACTGAAGATGACTTATATGATTTGCGAAATCAATGGGCA
ACTTGTTTTCTTGACTTGTATAACGCGTAG
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated