Overview
NameMedtr0054s0090.1
Unique NameMedtr0054s0090.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1224
Homology
BLAST of Medtr0054s0090.1 vs. NCBI nr
Match: gi|502098693|ref|XP_004491295.1| (PREDICTED: F-box protein CPR30-like [Cicer arietinum])
BLAST of Medtr0054s0090.1 vs. NCBI nr
Match: gi|502168373|ref|XP_004514373.1| (PREDICTED: F-box protein CPR30-like [Cicer arietinum])
BLAST of Medtr0054s0090.1 vs. NCBI nr
Match: gi|502171706|ref|XP_004515087.1| (PREDICTED: F-box protein CPR30-like [Cicer arietinum])
BLAST of Medtr0054s0090.1 vs. NCBI nr
Match: gi|502099101|ref|XP_004491389.1| (PREDICTED: F-box protein CPR30-like [Cicer arietinum])
BLAST of Medtr0054s0090.1 vs. NCBI nr
Match: gi|502146119|ref|XP_004506312.1| (PREDICTED: F-box protein CPR30-like [Cicer arietinum])
BLAST of Medtr0054s0090.1 vs. NCBI nr
Match: gi|502154821|ref|XP_004509851.1| (PREDICTED: putative F-box protein At3g16210-like [Cicer arietinum])
BLAST of Medtr0054s0090.1 vs. NCBI nr
Match: gi|502089309|ref|XP_004488869.1| (PREDICTED: F-box/kelch-repeat protein At3g06240-like [Cicer arietinum])
BLAST of Medtr0054s0090.1 vs. NCBI nr
Match: gi|502145990|ref|XP_004506271.1| (PREDICTED: F-box protein CPR30-like, partial [Cicer arietinum])
BLAST of Medtr0054s0090.1 vs. NCBI nr
Match: gi|502124426|ref|XP_004498525.1| (PREDICTED: F-box protein CPR30-like [Cicer arietinum])
BLAST of Medtr0054s0090.1 vs. NCBI nr
Match: gi|502124436|ref|XP_004498529.1| (PREDICTED: F-box protein CPR30-like [Cicer arietinum])
The following BLAST results are available for this feature:
BLAST of Medtr0054s0090.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502098693|ref|XP_004491295.1|1.687970e-10947.72PREDICTED: F-box protein CPR30-like [Cicer arietin... [more]
gi|502168373|ref|XP_004514373.1|1.433140e-10246.45PREDICTED: F-box protein CPR30-like [Cicer arietin... [more]
gi|502171706|ref|XP_004515087.1|1.697700e-10246.82PREDICTED: F-box protein CPR30-like [Cicer arietin... [more]
gi|502099101|ref|XP_004491389.1|4.148020e-9843.51PREDICTED: F-box protein CPR30-like [Cicer arietin... [more]
gi|502146119|ref|XP_004506312.1|5.776630e-9846.19PREDICTED: F-box protein CPR30-like [Cicer arietin... [more]
gi|502154821|ref|XP_004509851.1|2.841750e-9746.81PREDICTED: putative F-box protein At3g16210-like [... [more]
gi|502089309|ref|XP_004488869.1|1.539600e-9245.26PREDICTED: F-box/kelch-repeat protein At3g06240-li... [more]
gi|502145990|ref|XP_004506271.1|1.192520e-9147.51PREDICTED: F-box protein CPR30-like, partial [Cice... [more]
gi|502124426|ref|XP_004498525.1|1.442750e-9144.92PREDICTED: F-box protein CPR30-like [Cicer arietin... [more]
gi|502124436|ref|XP_004498529.1|2.746820e-9147.52PREDICTED: F-box protein CPR30-like [Cicer arietin... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR017451F-box associated interaction domainTIGRFAMsTIGR01640F_box_assoc_1: F-box protein interactiocoord: 120..376
score: 1.4
NoneNo IPR availableGENE3D1.20.1280.50no descriptioncoord: 18..85
score: 0.0

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0054s0090.1 ID=Medtr0054s0090.1|Name=Medtr0054s0090.1|organism=Medicago truncatula|type=mRNA|length=1224bp
ATGAAGAAGAAATCAGCGGCTGCAACAAATGCAAAGGTGCACAATTATAT
ATCAGACGATATTTCCTTCACAATTCTATCCAAACTCCCTCTTAAATCTT
TGAACCGATTTCGATGCGTTCGTAAATCATGGTCACTCTTATTTGAAAAC
CAACATCTCATGAACATGATCCGCAAAAATTTCTTATGTAATTTGAATTG
TTGTTCTTATTACGACCAAGCATCTCTCCTCCTGAAATACTTGGATGAAA
CCCACAAAGATATTTTGTATTCTCTTTCTCATGAGAGGTTTGAGAATAAA
GTAAAATTAGATTGCACAAATGTAATCGATCACCTATATATTTTTCGTAT
CTTTGGTCTTGGCAGTATTAATGGCATTGTTTGTGTTCATGCAAATTGTG
GTGCAATTGTATTTTGGAACCCAGCTACCCAAGCAATAAAACTCATTCCT
CCTAGTCCTCTTGAGTTGGTTGAGTTGCCTATCCCTGGTGTTGCTAAGGA
ATTCGTTAATGTTGAAGCTTTTACTTATCTTCATGGATTTGGTTATGATA
GTGTTATAGATGACTATAAGGTTATCTGTCTTGTATCTTTTGATATCCAA
GTAGAATTGGTAGATACATTTTCAGACTCCTTATTGGAAGATATATACTT
GGATGAATTATGGGAGATATATAGCCTAAGAAGTAACTCGTGGAGGAAAC
TTGATATTGACATGCCATCTTCTTCTTACTGTATAGAGGGAACCCAAGTC
TACATGGATGGAGTGTGTCATTGGTTGTGTGAAGAGAATACCCCTGCTGG
ACCATGTTTAGTATCATTTTACTTGAGAAATGAGGTGTTCTGTATAACAC
CCATACCCTCGGATGAAGATGACTGTTTTAAATTTAAAGCTTCATCGATA
AATTTGGTGTTATTAAATGGTTCCATTTCCTTGATCGCGTTTCATCGGGA
GACTACTACTTTTGACATAGCAATTTTGGGTGAACTCGGCATTAAGGAAT
CGTGGACCAAACTCTTCACTGTTGGACCGTTGTCTTGCGTTGAGCGTCCT
ATCAGAGTGGGGACGAAAGGGGAAATTTTCTTCCAAAGGAAAGATAATGA
ATTAGCTTGGTTTGATCTAAGTACCCAAGTGATTGAAGAGCTTGGTTATA
AAGCAAGGGGTCCTTATACTCGGATATCACTATACAAGGAAAACATTCTT
GCCATTGAAGGAATAAGTAATTAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR017451F-box associated interaction domain
noIPRunintegrated