Overview
NameMedtr0052s0130.1
Unique NameMedtr0052s0130.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1638
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0032774 RNA biosynthetic process
biological_process GO:0016070 RNA metabolic process
biological_process GO:0019438 aromatic compound biosynthetic process
biological_process GO:0065007 biological regulation
biological_process GO:0008150 biological_process
biological_process GO:0009058 biosynthetic process
biological_process GO:0008283 cell proliferation
biological_process GO:0006725 cellular aromatic compound metabolic process
biological_process GO:0044249 cellular biosynthetic process
biological_process GO:0034645 cellular macromolecule biosynthetic process
biological_process GO:0044260 cellular macromolecule metabolic process
biological_process GO:0044237 cellular metabolic process
biological_process GO:0044271 cellular nitrogen compound biosynthetic process
biological_process GO:0034641 cellular nitrogen compound metabolic process
biological_process GO:0009987 cellular process
biological_process GO:0010467 gene expression
biological_process GO:0018130 heterocycle biosynthetic process
biological_process GO:0046483 heterocycle metabolic process
biological_process GO:0009059 macromolecule biosynthetic process
biological_process GO:0043170 macromolecule metabolic process
biological_process GO:0008152 metabolic process
biological_process GO:0006807 nitrogen compound metabolic process
biological_process GO:0090304 nucleic acid metabolic process
biological_process GO:0034654 nucleobase-containing compound biosynthetic process
biological_process GO:0006139 nucleobase-containing compound metabolic process
biological_process GO:1901362 organic cyclic compound biosynthetic process
biological_process GO:1901360 organic cyclic compound metabolic process
biological_process GO:1901576 organic substance biosynthetic process
biological_process GO:0071704 organic substance metabolic process
biological_process GO:0044238 primary metabolic process
biological_process GO:0009303 rRNA transcription
biological_process GO:2001141 regulation of RNA biosynthetic process
biological_process GO:0051252 regulation of RNA metabolic process
biological_process GO:0050789 regulation of biological process
biological_process GO:0009889 regulation of biosynthetic process
biological_process GO:0031326 regulation of cellular biosynthetic process
biological_process GO:2000112 regulation of cellular macromolecule biosynthetic process
biological_process GO:0031323 regulation of cellular metabolic process
biological_process GO:0050794 regulation of cellular process
biological_process GO:0010468 regulation of gene expression
biological_process GO:0010556 regulation of macromolecule biosynthetic process
biological_process GO:0060255 regulation of macromolecule metabolic process
biological_process GO:0019222 regulation of metabolic process
biological_process GO:0051171 regulation of nitrogen compound metabolic process
biological_process GO:0019219 regulation of nucleobase-containing compound metabolic process
biological_process GO:0080090 regulation of primary metabolic process
biological_process GO:0006355 regulation of transcription, DNA-templated
biological_process GO:0044699 single-organism process
biological_process GO:0006351 transcription, DNA-templated
molecular_function GO:0003677 DNA binding
molecular_function GO:0005488 binding
molecular_function GO:0003690 double-stranded DNA binding
molecular_function GO:1901363 heterocyclic compound binding
molecular_function GO:0003674 molecular_function
molecular_function GO:0003676 nucleic acid binding
molecular_function GO:0001071 nucleic acid binding transcription factor activity
molecular_function GO:0097159 organic cyclic compound binding
molecular_function GO:0005515 protein binding
molecular_function GO:0003700 sequence-specific DNA binding transcription factor activity
molecular_function GO:0043566 structure-specific DNA binding
molecular_function GO:0008134 transcription factor binding
Homology
BLAST of Medtr0052s0130.1 vs. NCBI nr
Match: gi|356547715|ref|XP_003542256.1| (PREDICTED: uncharacterized protein LOC100793251 [Glycine max])
BLAST of Medtr0052s0130.1 vs. NCBI nr
Match: gi|356561476|ref|XP_003549007.1| (PREDICTED: uncharacterized protein LOC100791537 [Glycine max])
BLAST of Medtr0052s0130.1 vs. NCBI nr
Match: gi|502128409|ref|XP_004499953.1| (PREDICTED: uncharacterized protein LOC101515119 [Cicer arietinum] >gi|502128999|ref|XP_004500148.1| PREDICTED: uncharacterized protein LOC101513061 [Cicer arietinum] >gi|502180938|ref|XP_004516722.1| PREDICTED: uncharacterized protein LOC101503288 [Cicer arietinum] >gi|502181260|ref|XP_004516768.1| PREDICTED: uncharacterized protein LOC101496645 [Cicer arietinum])
BLAST of Medtr0052s0130.1 vs. NCBI nr
Match: gi|388496598|gb|AFK36365.1| (unknown [Lotus japonicus])
BLAST of Medtr0052s0130.1 vs. NCBI nr
Match: gi|502166282|ref|XP_004513846.1| (PREDICTED: uncharacterized protein LOC101505414 [Cicer arietinum])
BLAST of Medtr0052s0130.1 vs. NCBI nr
Match: gi|356547768|ref|XP_003542281.1| (PREDICTED: uncharacterized protein LOC100808462 [Glycine max])
BLAST of Medtr0052s0130.1 vs. NCBI nr
Match: gi|356545555|ref|XP_003541205.1| (PREDICTED: uncharacterized protein LOC100787432, partial [Glycine max])
BLAST of Medtr0052s0130.1 vs. NCBI nr
Match: gi|356545580|ref|XP_003541217.1| (PREDICTED: uncharacterized protein LOC100795351 [Glycine max])
BLAST of Medtr0052s0130.1 vs. NCBI nr
Match: gi|356545584|ref|XP_003541219.1| (PREDICTED: uncharacterized protein LOC100796402 [Glycine max])
BLAST of Medtr0052s0130.1 vs. NCBI nr
Match: gi|356545558|ref|XP_003541206.1| (PREDICTED: uncharacterized protein LOC100788489 [Glycine max])
The following BLAST results are available for this feature:
BLAST of Medtr0052s0130.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|356547715|ref|XP_003542256.1|3.431320e-9582.16PREDICTED: uncharacterized protein LOC100793251 [G... [more]
gi|356561476|ref|XP_003549007.1|2.881860e-8379.06PREDICTED: uncharacterized protein LOC100791537 [G... [more]
gi|502128409|ref|XP_004499953.1|2.860830e-7996.83PREDICTED: uncharacterized protein LOC101515119 [C... [more]
gi|388496598|gb|AFK36365.1|8.221350e-7996.83unknown [Lotus japonicus][more]
gi|502166282|ref|XP_004513846.1|3.357440e-7896.03PREDICTED: uncharacterized protein LOC101505414 [C... [more]
gi|356547768|ref|XP_003542281.1|6.711580e-7895.24PREDICTED: uncharacterized protein LOC100808462 [G... [more]
gi|356545555|ref|XP_003541205.1|7.559380e-7895.24PREDICTED: uncharacterized protein LOC100787432, p... [more]
gi|356545580|ref|XP_003541217.1|6.815550e-7795.24PREDICTED: uncharacterized protein LOC100795351 [G... [more]
gi|356545584|ref|XP_003541219.1|2.611840e-7695.24PREDICTED: uncharacterized protein LOC100796402 [G... [more]
gi|356545558|ref|XP_003541206.1|1.199590e-7595.24PREDICTED: uncharacterized protein LOC100788489 [G... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableSEGsegsegcoord: 175..186
score: NAcoord: 293..305
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0052s0130.1 ID=Medtr0052s0130.1|Name=Medtr0052s0130.1|organism=Medicago truncatula|type=mRNA|length=1638bp
ATGATAGGAAGAGCCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAA
CGCTTGGCTGCCACAAGCCAGTTATCCCTGTGGTAACTTTTCTGACACCT
CTAGCTTCAAATTCCGAAGGTCTAAAGGATCGATAGGCCACGCTTTCACG
GTTCGTATTCGTACTGGAAATCAGAATCAAACGAGCTTTTACCCTTTTGT
TCCACACGAGATTTCTGTTCTCGTTGAGCTCATCTTAGGACACCTGCGTT
ATCTTTTAACAGATGTGCCGCCCCAGCCAAACTCCCCACCTGACAATGTC
TTCCGCCCGGATCGGCCAACCAAAGTCGGCCTTGGATCTAAAAAGAGGGG
CAGCGCCCCGCCTCCGATTCACGGAATAATCGGACTAGAGTCAAGCTCAA
CAGGGTCTTCTTTCCCCGCTGATTCCGCCAAGCCCGTTCCCTTGGCTGTG
GTTTCGCTGGATAGTAGACAGGGACAAGGACCAAAAGGTCCCGTTCCCAG
TCCGTCCCCCGACCGGCACGCGTCGACCCGCTCTCGCCGCGGGAGCAGCT
CAAGCAGTCCGCCAACAGCCGACGGGTTCGAAACTGGGACCCCCGTGCCT
AGCCCTCAGAGCCAATCCTTTTCCCGAGGTTACGGATCCATTTTGCCGAC
TTCCCTTGCCTACATTGTTCCATCGACCAGAGGCTGTTCACCTTGGAGAC
CTGATGCGGTTATGAGTACGACCGGGCATGGAAGGCACTCGGTCCTCCAG
ATTTTCAAGGGCCGCCAGGGGCGCACCGGACACCACGCGACGTGCGGTGC
TCTTCCAGCCGCTGGACCCTACCTCCGGCTGAGCCGTTTCCAGGGTGGGC
AGGCTATCTGCACCGACGACCGCTCCGCCCAGGCTCACGCCCCGGGTTTT
GCAGCGACCGCCGCGCCCTCCTACTCATCAGGGCCTGGCCCTTGCCCCAA
CGGCCGGGTTAGCGCGCAGTTGGGCACCGTAACCCAGCTTCCGGTTCATC
CCGCATCGCCAGTTCTGCTTACCAAAAATGGCCCACTTGGAGCTCTCGAT
TCCATGGCATGGCTCAACAGAGCAGCCACACCGTCCTACCTATTTAAATC
TTTCGCCCCTATACCCAAGTCAGACGAACGATTTGCACGTCAGTATCGCT
GTGGGCCTCCACCAGAGTTTCCTCTGGCTTCGCCCCGCTCAGGCATAGTT
CACCATCTTTCGGGTCCCGACAGGTATGCTCTCACTCGAACCCTTCACAA
AAGATCGGGGTCGGTCGGCGGTGCAACCCACAAGAGGATCCCACCAATCA
GCTTCCTTGCGCCTAACGGGTTTACTCACCCGTTGACTCGCACACATGTT
AGACTCCTTGGTCCGTGTTTCAAGACGGGTCGAATGGGGAGCCCACAGGC
CGACGCCAGGAGCGCGCATGTGCCGAAGCACGCCGAATCAGCGCGCGCTG
TAGCCCACAATCGTGATGATGACGTCTCCGCGAGCATTTCAACAACCCAG
GCTTGGGCCACCATCACAATCCGCGTCGGTCAATGTCCCGAGCCGATTGG
CGGACCGGCACAAACCGTTCCACATCCGACCGAGACACATCGCCGGCCCC
CATCCGCTTCCCTCCCGACAATTTCAAGCACTCTTTGA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0005515protein binding
GO:0001071nucleic acid binding transcription factor activity
GO:0003674molecular_function
GO:0003676nucleic acid binding
GO:0003677DNA binding
GO:0003690double-stranded DNA binding
GO:0003700sequence-specific DNA binding transcription factor activity
GO:0005488binding
GO:0008134transcription factor binding
GO:0043566structure-specific DNA binding
GO:0097159organic cyclic compound binding
GO:1901363heterocyclic compound binding
Vocabulary: Biological Process
TermDefinition
GO:0008152metabolic process
GO:0006139nucleobase-containing compound metabolic process
GO:0006351transcription, DNA-templated
GO:0006355regulation of transcription, DNA-templated
GO:0006725cellular aromatic compound metabolic process
GO:0006807nitrogen compound metabolic process
GO:0008150biological_process
GO:0008283cell proliferation
GO:0009058biosynthetic process
GO:0009059macromolecule biosynthetic process
GO:0009303rRNA transcription
GO:0009889regulation of biosynthetic process
GO:0009987cellular process
GO:0010467gene expression
GO:0010468regulation of gene expression
GO:0010556regulation of macromolecule biosynthetic process
GO:0016070RNA metabolic process
GO:0018130heterocycle biosynthetic process
GO:0019219regulation of nucleobase-containing compound metabolic process
GO:0019222regulation of metabolic process
GO:0019438aromatic compound biosynthetic process
GO:0031323regulation of cellular metabolic process
GO:0031326regulation of cellular biosynthetic process
GO:0032774RNA biosynthetic process
GO:0034641cellular nitrogen compound metabolic process
GO:0034645cellular macromolecule biosynthetic process
GO:0034654nucleobase-containing compound biosynthetic process
GO:0043170macromolecule metabolic process
GO:0044237cellular metabolic process
GO:0044238primary metabolic process
GO:0044249cellular biosynthetic process
GO:0044260cellular macromolecule metabolic process
GO:0044271cellular nitrogen compound biosynthetic process
GO:0044699single-organism process
GO:0046483heterocycle metabolic process
GO:0050789regulation of biological process
GO:0050794regulation of cellular process
GO:0051171regulation of nitrogen compound metabolic process
GO:0051252regulation of RNA metabolic process
GO:0060255regulation of macromolecule metabolic process
GO:0065007biological regulation
GO:0071704organic substance metabolic process
GO:0080090regulation of primary metabolic process
GO:0090304nucleic acid metabolic process
GO:1901360organic cyclic compound metabolic process
GO:1901362organic cyclic compound biosynthetic process
GO:1901576organic substance biosynthetic process
GO:2000112regulation of cellular macromolecule biosynthetic process
GO:2001141regulation of RNA biosynthetic process