Overview
NameMedtr0050s0160.1
Unique NameMedtr0050s0160.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1710
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0008150 biological_process
biological_process GO:0006812 cation transport
biological_process GO:0051234 establishment of localization
biological_process GO:0006811 ion transport
biological_process GO:0051179 localization
biological_process GO:0030001 metal ion transport
biological_process GO:0015672 monovalent inorganic cation transport
biological_process GO:0006813 potassium ion transport
biological_process GO:0044699 single-organism process
biological_process GO:0044765 single-organism transport
biological_process GO:0006810 transport
cellular_component GO:0005575 cellular_component
cellular_component GO:0016020 membrane
molecular_function GO:0022804 active transmembrane transporter activity
molecular_function GO:0005488 binding
molecular_function GO:0008324 cation transmembrane transporter activity
molecular_function GO:0019899 enzyme binding
molecular_function GO:0015503 glutathione-regulated potassium exporter activity
molecular_function GO:0022890 inorganic cation transmembrane transporter activity
molecular_function GO:0015075 ion transmembrane transporter activity
molecular_function GO:0046873 metal ion transmembrane transporter activity
molecular_function GO:0003674 molecular_function
molecular_function GO:0015077 monovalent inorganic cation transmembrane transporter activity
molecular_function GO:0015079 potassium ion transmembrane transporter activity
molecular_function GO:0005515 protein binding
molecular_function GO:0015291 secondary active transmembrane transporter activity
molecular_function GO:0022891 substrate-specific transmembrane transporter activity
molecular_function GO:0022892 substrate-specific transporter activity
molecular_function GO:0015643 toxic substance binding
molecular_function GO:0022857 transmembrane transporter activity
molecular_function GO:0005215 transporter activity
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00999.1659075-57966164-5332-384251.65.6e-79252.06e-75

Homology
BLAST of Medtr0050s0160.1 vs. NCBI nr
Match: gi|502146030|ref|XP_004506289.1| (PREDICTED: K(+) efflux antiporter 5-like isoform X2 [Cicer arietinum])
BLAST of Medtr0050s0160.1 vs. NCBI nr
Match: gi|502146027|ref|XP_004506288.1| (PREDICTED: K(+) efflux antiporter 5-like isoform X1 [Cicer arietinum])
BLAST of Medtr0050s0160.1 vs. NCBI nr
Match: gi|356561749|ref|XP_003549141.1| (PREDICTED: K(+) efflux antiporter 5-like [Glycine max])
BLAST of Medtr0050s0160.1 vs. NCBI nr
Match: gi|356529340|ref|XP_003533253.1| (PREDICTED: K(+) efflux antiporter 5-like [Glycine max])
BLAST of Medtr0050s0160.1 vs. NCBI nr
Match: gi|470145044|ref|XP_004308154.1| (PREDICTED: K(+) efflux antiporter 5-like [Fragaria vesca subsp. vesca])
BLAST of Medtr0050s0160.1 vs. NCBI nr
Match: gi|590672020|ref|XP_007038492.1| (Glutathione-regulated potassium-efflux system protein kefB [Theobroma cacao] >gi|508775737|gb|EOY22993.1| Glutathione-regulated potassium-efflux system protein kefB [Theobroma cacao])
BLAST of Medtr0050s0160.1 vs. NCBI nr
Match: gi|225455594|ref|XP_002269354.1| (PREDICTED: K(+) efflux antiporter 5 [Vitis vinifera] >gi|296084106|emb|CBI24494.3| unnamed protein product [Vitis vinifera])
BLAST of Medtr0050s0160.1 vs. NCBI nr
Match: gi|460376734|ref|XP_004234152.1| (PREDICTED: K(+) efflux antiporter 5-like [Solanum lycopersicum])
BLAST of Medtr0050s0160.1 vs. NCBI nr
Match: gi|596021018|ref|XP_007218961.1| (hypothetical protein PRUPE_ppa003565mg [Prunus persica] >gi|462415423|gb|EMJ20160.1| hypothetical protein PRUPE_ppa003565mg [Prunus persica])
BLAST of Medtr0050s0160.1 vs. NCBI nr
Match: gi|449460782|ref|XP_004148124.1| (PREDICTED: K(+) efflux antiporter 5-like [Cucumis sativus] >gi|449499664|ref|XP_004160879.1| PREDICTED: K(+) efflux antiporter 5-like [Cucumis sativus])
The following BLAST results are available for this feature:
BLAST of Medtr0050s0160.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502146030|ref|XP_004506289.1|0.000000e+095.54PREDICTED: K(+) efflux antiporter 5-like isoform X... [more]
gi|502146027|ref|XP_004506288.1|0.000000e+096.16PREDICTED: K(+) efflux antiporter 5-like isoform X... [more]
gi|356561749|ref|XP_003549141.1|0.000000e+091.64PREDICTED: K(+) efflux antiporter 5-like [Glycine ... [more]
gi|356529340|ref|XP_003533253.1|0.000000e+090.21PREDICTED: K(+) efflux antiporter 5-like [Glycine ... [more]
gi|470145044|ref|XP_004308154.1|0.000000e+083.51PREDICTED: K(+) efflux antiporter 5-like [Fragaria... [more]
gi|590672020|ref|XP_007038492.1|0.000000e+083.92Glutathione-regulated potassium-efflux system prot... [more]
gi|225455594|ref|XP_002269354.1|0.000000e+085.92PREDICTED: K(+) efflux antiporter 5 [Vitis vinifer... [more]
gi|460376734|ref|XP_004234152.1|0.000000e+081.45PREDICTED: K(+) efflux antiporter 5-like [Solanum ... [more]
gi|596021018|ref|XP_007218961.1|0.000000e+085.38hypothetical protein PRUPE_ppa003565mg [Prunus per... [more]
gi|449460782|ref|XP_004148124.1|0.000000e+081.85PREDICTED: K(+) efflux antiporter 5-like [Cucumis ... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableSEGsegsegcoord: 4..18
score: NAcoord: 164..176
score: NAcoord: 215..228
score: NAcoord: 339..354
score: NAcoord: 450..471
score: NAcoord: 515..528
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0050s0160.1 ID=Medtr0050s0160.1|Name=Medtr0050s0160.1|organism=Medicago truncatula|type=mRNA|length=1710bp
ATGTCACCGAAGAAGAAATGGATATGGTGTTGTTGCGTGATCGTGATCTG
TTGTGCTAGGGTTTGTTCATCTGGTAGATCCGATAAAGAAACGCGTGATA
GGTTTTATGGGAACATGCTTAATTCTACTGCTCCTGAATCTAATGATGGT
TCTTTGGCTAAAATGTTCGATCGTGTTCTTGAGAAAGAGTTTTCTGAAAA
TGATCAACCTGAAGAGCCTGATAAAAACAGCTTCAATAGCACTGTGGCTG
ATCAGCAGGGAGTATTGGAGACTGTAGCTAAAATTACTCATGATAAAGCT
AAGAGAAATGATACGCGTGAGGGAAATGGCACAAGATCATTTCAGTTTCA
AGACGTGTTCTCTTTGGAAAATGAGGATTCTGATGATGTGACAACCTTGA
TTGACAAAAAGGACAATGTCTTTGTGATGTCAAACAAGAAATCCAAATAT
CCCGTGCTTCAAGTCGATTTGAGGCTAATATCAGATTTGGTGGTCATCAT
CGTTTCTGCAGCCATCGGTGGAATTGTCTTTTCCTGTTTGGGGCAACCGG
TTATTGTGGGCTATCTTCTTGCAGGCTCCCTCATTGGACCAGGGGGTTTG
AAATTCATTAGTGAAATGGTTCAGGTTGAAACGGTCGCACAATTTGGGGT
GGTATTTCTTCTGTTTGCTTTGGGGCTGGAGTTTTCCTTGGCCAAGTTAA
AAGCTGTGGGGCCTGTTGCTGTTCTTGGAGGGCTACTTCAAATTGTAATA
TTCATGTTCCTTTGTGGAATTCTTGCCATGTTATGTGGAGGAAAATTGTC
TGAGGGTGTTTTTGTTGGTTCCTTTCTGTCAATGTCATCAACAGCAGTGG
TGGTAAAGTTTTTGGTGGAGAGGAATACTAATAATGCTCTTCATGTTCAA
GTTACAATTGGCACTCTTATTTTTCAGGACTGTGCTGTGGGTTTACTATT
TGCTTTGCTCCCTGTCTTGGGTGGTAACAGTGGTCTTTTACAAGGGATTA
TTTCAATGGGAAAACTGTTGCTAGTATTGTCCTTGTATCTCACTGCTACA
TCTGTACTGTCTTGGTCGTTTGTTCCTCGCTTTCTAAAACTAATGATGAG
GCTTTCATCTCAGACAAATGAACTTTATCAGCTAGCTGCTGTTGCTTTCT
GCTTGTTATCTGCATGGTGCAGTTATAAGCTTGGTCTTAGTCTTGAGCTG
GGTTCATTTATGGCTGGTGTTATGATTTCTACAACAGACTTTGCTCAACA
TACTTTGGACCAGGTGGAACCGATTCGTAACCTTTTTGCAGCTCTCTTCC
TCTCAAGTATTGGAATGCTTATACATGTGCAGTTCCTTTGGAACCATGTG
GATATCTTGCTTGCATCTGTTATTTTGGTTGTTGTTGTTAAGACTGCTGT
TGTTGCTATAGTTACAAAGGCCTTCGGGTACAGTCTTAAGACAGCATTTA
TTGTTGGTATCTCACTTGCTCAAATTGGAGAATTTGCTTTTGTTCTGCTG
AGTCGTGCTTCAAATCTTCATCTTGTTGAGGGGAAAATGTATCTTCTCCT
TCTAGGGACGACGGCTCTCAGTCTGGTCACCACACCGCTTTTGTTTAAAT
TGATACCGGCTGTCATGAATCTGGGTGTTCTCATGCACTGGTTCCCTTCA
GAAAATGGCACACAAATTGAGGGCAAATCTTTGATGATTGAGGCAAACAG
AATGTTGTGA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0005515protein binding
GO:0003674molecular_function
GO:0046873metal ion transmembrane transporter activity
GO:0005215transporter activity
GO:0022857transmembrane transporter activity
GO:0015291secondary active transmembrane transporter activity
GO:0005488binding
GO:0008324cation transmembrane transporter activity
GO:0015075ion transmembrane transporter activity
GO:0015077monovalent inorganic cation transmembrane transporter activity
GO:0015079potassium ion transmembrane transporter activity
GO:0015503glutathione-regulated potassium exporter activity
GO:0015643toxic substance binding
GO:0019899enzyme binding
GO:0022804active transmembrane transporter activity
GO:0022891substrate-specific transmembrane transporter activity
GO:0022890inorganic cation transmembrane transporter activity
GO:0022892substrate-specific transporter activity
Vocabulary: Cellular Component
TermDefinition
GO:0005575cellular_component
GO:0016020membrane
Vocabulary: Biological Process
TermDefinition
GO:0006810transport
GO:0006811ion transport
GO:0006812cation transport
GO:0006813potassium ion transport
GO:0030001metal ion transport
GO:0008150biological_process
GO:0015672monovalent inorganic cation transport
GO:0044699single-organism process
GO:0044765single-organism transport
GO:0051179localization
GO:0051234establishment of localization