Overview
NameMedtr0050s0090.1
Unique NameMedtr0050s0090.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length600
Homology
BLAST of Medtr0050s0090.1 vs. NCBI nr
Match: gi|590653124|ref|XP_007033335.1| (Uncharacterized protein TCM_019516, partial [Theobroma cacao] >gi|508712364|gb|EOY04261.1| Uncharacterized protein TCM_019516, partial [Theobroma cacao])
BLAST of Medtr0050s0090.1 vs. NCBI nr
Match: gi|590633748|ref|XP_007028192.1| (Uncharacterized protein TCM_023754 [Theobroma cacao] >gi|508716797|gb|EOY08694.1| Uncharacterized protein TCM_023754 [Theobroma cacao])
BLAST of Medtr0050s0090.1 vs. NCBI nr
Match: gi|590724789|ref|XP_007052567.1| (Gag-pol polyprotein, putative [Theobroma cacao] >gi|508704828|gb|EOX96724.1| Gag-pol polyprotein, putative [Theobroma cacao])
BLAST of Medtr0050s0090.1 vs. NCBI nr
Match: gi|590639839|ref|XP_007029783.1| (Uncharacterized protein TCM_025656 [Theobroma cacao] >gi|508718388|gb|EOY10285.1| Uncharacterized protein TCM_025656 [Theobroma cacao])
BLAST of Medtr0050s0090.1 vs. NCBI nr
Match: gi|590565089|ref|XP_007009850.1| (Uncharacterized protein TCM_043155 [Theobroma cacao] >gi|508726763|gb|EOY18660.1| Uncharacterized protein TCM_043155 [Theobroma cacao])
BLAST of Medtr0050s0090.1 vs. NCBI nr
Match: gi|590714907|ref|XP_007050047.1| (Uncharacterized protein TCM_003699 [Theobroma cacao] >gi|508702308|gb|EOX94204.1| Uncharacterized protein TCM_003699 [Theobroma cacao])
BLAST of Medtr0050s0090.1 vs. NCBI nr
Match: gi|147838439|emb|CAN63255.1| (hypothetical protein VITISV_028489 [Vitis vinifera])
BLAST of Medtr0050s0090.1 vs. NCBI nr
Match: gi|310753569|gb|ADP20181.1| (mutant gag-pol polyprotein [Pisum sativum])
BLAST of Medtr0050s0090.1 vs. NCBI nr
Match: gi|310753567|gb|ADP20180.1| (mutant gag-pol polyprotein [Pisum sativum])
BLAST of Medtr0050s0090.1 vs. NCBI nr
Match: gi|356506698|ref|XP_003522113.1| (PREDICTED: uncharacterized protein LOC100796705 [Glycine max])
The following BLAST results are available for this feature:
BLAST of Medtr0050s0090.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|590653124|ref|XP_007033335.1|2.559450e-1732.07Uncharacterized protein TCM_019516, partial [Theob... [more]
gi|590633748|ref|XP_007028192.1|1.168530e-1533.54Uncharacterized protein TCM_023754 [Theobroma caca... [more]
gi|590724789|ref|XP_007052567.1|2.555450e-1531.18Gag-pol polyprotein, putative [Theobroma cacao] >g... [more]
gi|590639839|ref|XP_007029783.1|4.972980e-1533.99Uncharacterized protein TCM_025656 [Theobroma caca... [more]
gi|590565089|ref|XP_007009850.1|5.837080e-1535.29Uncharacterized protein TCM_043155 [Theobroma caca... [more]
gi|590714907|ref|XP_007050047.1|8.543100e-1536.89Uncharacterized protein TCM_003699 [Theobroma caca... [more]
gi|147838439|emb|CAN63255.1|1.548300e-833.68hypothetical protein VITISV_028489 [Vitis vinifera... [more]
gi|310753569|gb|ADP20181.1|2.089280e-829.60mutant gag-pol polyprotein [Pisum sativum][more]
gi|310753567|gb|ADP20180.1|4.295210e-826.32mutant gag-pol polyprotein [Pisum sativum][more]
gi|356506698|ref|XP_003522113.1|2.350550e-731.20PREDICTED: uncharacterized protein LOC100796705 [G... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
BlastP Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0050s0090.1 ID=Medtr0050s0090.1|Name=Medtr0050s0090.1|organism=Medicago truncatula|type=mRNA|length=600bp
ATGTATGACGAAGAATATCTTCATGTTGAATATGGTGAATCTTTGGAGGT
TAAAAGAAGCTTGCAAACAACAATAGCCAAAGACATGGTTTGTAATGCTA
TCGTCGATAACAAAAGTTGTGAAAATTTTGCATCAAACTATATAGCAGAA
AAGTTAAAGTCCCAACCGAGTAATCGCCAAGATCCATACAAGCTGCAATG
GCTCAACAAGGATAATGAGAAAATTTATGGTGTGATGTTATTCCGATGGA
AATTTCCCACATTCACGATGCCTTGTCAATATGATCATCGTGCATTATAC
GATGGTTATGCCAATACCTGCACTTTCTTGAAAGATGTGATTGAAATCAA
CTTGGCACCTCTACCACTCAATGAATTCAATGATGGAAAAAAGGAATTCA
AGCAACTTGGACTTTCACTCGCAAAGGAACCATTCAAGAAGAAAACAAAG
TTATACATATCTCGTCTAGATCCTAAGCCACCTTGGGAAGATGTTACTAT
TAATTTTTCCCTTGGATTACTTTGGACTCGAAAACTAAAGGATTCCAAAA
TGGTAGTCGAAGACAAGTCTTCAAAAATGGCTCATTTCATCATATGGTAG
back to top