Overview
NameMedtr0049s0110.1
Unique NameMedtr0049s0110.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1266
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
molecular_function GO:0005515 protein binding
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00646.2874305-741989-442-3725.96.9e-1025.94.7e-06

Homology
BLAST of Medtr0049s0110.1 vs. NCBI nr
Match: gi|502094807|ref|XP_004490302.1| (PREDICTED: F-box/FBD/LRR-repeat protein At1g13570-like [Cicer arietinum])
BLAST of Medtr0049s0110.1 vs. NCBI nr
Match: gi|502094802|ref|XP_004490301.1| (PREDICTED: F-box/FBD/LRR-repeat protein At1g13570-like [Cicer arietinum])
BLAST of Medtr0049s0110.1 vs. NCBI nr
Match: gi|356499986|ref|XP_003518816.1| (PREDICTED: F-box/FBD/LRR-repeat protein At1g13570 [Glycine max])
BLAST of Medtr0049s0110.1 vs. NCBI nr
Match: gi|356498124|ref|XP_003517903.1| (PREDICTED: F-box/FBD/LRR-repeat protein At1g13570-like [Glycine max])
BLAST of Medtr0049s0110.1 vs. NCBI nr
Match: gi|590698270|ref|XP_007045671.1| (F-box/RNI-like superfamily protein isoform 1 [Theobroma cacao] >gi|508709606|gb|EOY01503.1| F-box/RNI-like superfamily protein isoform 1 [Theobroma cacao])
BLAST of Medtr0049s0110.1 vs. NCBI nr
Match: gi|596142590|ref|XP_007222555.1| (hypothetical protein PRUPE_ppa006232mg [Prunus persica] >gi|462419491|gb|EMJ23754.1| hypothetical protein PRUPE_ppa006232mg [Prunus persica])
BLAST of Medtr0049s0110.1 vs. NCBI nr
Match: gi|224111790|ref|XP_002315980.1| (F-box family protein [Populus trichocarpa] >gi|222865020|gb|EEF02151.1| F-box family protein [Populus trichocarpa])
BLAST of Medtr0049s0110.1 vs. NCBI nr
Match: gi|255546959|ref|XP_002514537.1| (ubiquitin-protein ligase, putative [Ricinus communis] >gi|223546141|gb|EEF47643.1| ubiquitin-protein ligase, putative [Ricinus communis])
BLAST of Medtr0049s0110.1 vs. NCBI nr
Match: gi|470122288|ref|XP_004297176.1| (PREDICTED: F-box/FBD/LRR-repeat protein At1g13570-like [Fragaria vesca subsp. vesca])
BLAST of Medtr0049s0110.1 vs. NCBI nr
Match: gi|359473651|ref|XP_002270150.2| (PREDICTED: F-box/FBD/LRR-repeat protein At1g13570-like [Vitis vinifera])
The following BLAST results are available for this feature:
BLAST of Medtr0049s0110.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502094807|ref|XP_004490302.1|0.000000e+083.45PREDICTED: F-box/FBD/LRR-repeat protein At1g13570-... [more]
gi|502094802|ref|XP_004490301.1|0.000000e+074.88PREDICTED: F-box/FBD/LRR-repeat protein At1g13570-... [more]
gi|356499986|ref|XP_003518816.1|0.000000e+074.76PREDICTED: F-box/FBD/LRR-repeat protein At1g13570 ... [more]
gi|356498124|ref|XP_003517903.1|0.000000e+073.70PREDICTED: F-box/FBD/LRR-repeat protein At1g13570-... [more]
gi|590698270|ref|XP_007045671.1|0.000000e+071.56F-box/RNI-like superfamily protein isoform 1 [Theo... [more]
gi|596142590|ref|XP_007222555.1|0.000000e+069.67hypothetical protein PRUPE_ppa006232mg [Prunus per... [more]
gi|224111790|ref|XP_002315980.1|0.000000e+066.82F-box family protein [Populus trichocarpa] >gi|222... [more]
gi|255546959|ref|XP_002514537.1|0.000000e+065.88ubiquitin-protein ligase, putative [Ricinus commun... [more]
gi|470122288|ref|XP_004297176.1|0.000000e+066.04PREDICTED: F-box/FBD/LRR-repeat protein At1g13570-... [more]
gi|359473651|ref|XP_002270150.2|0.000000e+062.23PREDICTED: F-box/FBD/LRR-repeat protein At1g13570-... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR001810F-box domain, cyclin-likePROFILEPS50181FBOXcoord: 7..60
score: 9
IPR006566FBD-likeSMARTSM00579no descriptioncoord: 347..418
score: 1.2
IPR022364F-box domain, Skp2-likeSUPERFAMILY81383F-box domaincoord: 5..104
score: 2.4
NoneNo IPR availableGENE3D3.80.10.10no descriptioncoord: 110..242
score: 8.4
NoneNo IPR availableSEGsegsegcoord: 112..124
score
NoneNo IPR availableSUPERFAMILY52047RNI-likecoord: 106..349
score: 2.2

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0049s0110.1 ID=Medtr0049s0110.1|Name=Medtr0049s0110.1|organism=Medicago truncatula|type=mRNA|length=1266bp
ATGGATGATTTTTCGGGTCCTGATTTGATCAGTGACCTTCCTCAAAGTAT
TATAGAAACCATTTTGATACAACTTCCTATAAGAGATGCTGTTAGAACTA
GCATTTTGTCGCGTAAATGGCGGTACAAATGGTCCACAATTACTCAGCTT
GTTTTCGACGAAAAATGTTACCCTAACTCAACCGACCGAGAAGTTGTTCA
AAAAAGTGTTGTTGAGTTTATTACCCGATTGCTGTTTCTTCACCAAGGGC
CAATTCATAAGTTTCAAATTGTGAATACAAGCTTGCAGACCTGCCCTGCT
ATAAATCAGTGGATTCTTTTCCTTTCGAGAAATGATCTTAAAGATTTGGA
TCTTGAATTGGGAGAAGGTGAATTCTTTAGAATGCCGTCATGTTTTTTTA
GTTGCGAGAAATTGACTCGATTGGAGCTCTCGCGCTGCGAGTTGTATCCG
CCTGCTAGTTTTAAGGGATTTTCGTATTTGAAGTGTCTCAATCTTCATCA
AGTTTTGATATCCCCTGAAGCAATTGAGAGCCTCATTTCAAGTTGCCCTC
TATTGGAGAACTTATCGCTGTCATACTTTGACTGTTTAGCTCTTACTGTA
CGTGCTCCAAATCTCAAGTACTTGTGCCTTGAAGGCGAATTCAAGGAAAT
TTGTCTTGTAGATACTCCACTCTTGGTTGAATTATCTGTTGCTATGTATA
TGACTGACGAGCACATGGAGCAAAGCTCAACTTGCAATTTTGTCAAGTTT
CTTGGCGGTGTGCCTAACCTCGAGAGACTTGTTGGTCTTATTGACTTCAC
AAAGTATTTGAGCATAGGTAATGACCTAGGGCATCTTGCTATAATGTACA
ACAATTTAGAGACTATTGAAATGTATCAAGTAAGTTTTGAGGATATGAAA
GAAATACTTGTCGTCTTTCGTTTGATTACAAGCTCTCCTAATTTAAAAGA
ACTTCACATTTCGGGTTCATCAAACATATCAAATGCCCCGTATGCTGGAT
ATGCAGGTTTGGATTTTTGGGAAAAAGAATGCCCTTCGGATTCTATACTT
GGTCAGCTTAAACTTGTGAAGTTGACAGAAATGAGCGGTATGCCACATGA
GATCGAATTTATCAGATTTTTGCTTGGATGTTCACCTATGCTGGAGACAA
TGAGTATCATTCCTGCTATGTATGATTTGGATTGTCAATTGAAAATGGTG
GTCGAACTGATGAAATTTCGAAGAGCTTCTACCAGAGCAGAAATTTATTT
CATCCGCGGAGATTAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR001810F-box domain, cyclin-like
IPR006566FBD-like
IPR022364F-box domain, Skp2-like
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0005515protein binding