Overview
NameMedtr0049s0100.1
Unique NameMedtr0049s0100.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length186
Homology
BLAST of Medtr0049s0100.1 vs. NCBI nr
Match: gi|9838391|ref|NP_064003.1| (orf300 gene product (mitochondrion) [Beta vulgaris subsp. vulgaris] >gi|323435152|ref|YP_004222370.1| hypothetical protein BevumaM_p137 [Beta vulgaris subsp. maritima] >gi|346683243|ref|YP_004842175.1| hypothetical protein BemaM_p131 [Beta macrocarpa] >gi|9049305|dbj|BAA99315.1| orf300 [Beta vulgaris subsp. vulgaris] >gi|317905602|emb|CBJ14009.1| hypothetical protein [Beta vulgaris subsp. maritima] >gi|319439885|emb|CBJ17585.1| hypothetical protein [Beta vulgaris subsp. maritima] >gi|320148039|emb|CBJ20703.1| hypothetical protein [Beta vulgaris subsp. maritima] >gi|345500161|emb|CBX24980.1| hypothetical protein [Beta macrocarpa] >gi|384977913|emb|CBL54137.1| hypothetical protein (mitochondrion) [Beta vulgaris subsp. maritima])
BLAST of Medtr0049s0100.1 vs. NCBI nr
Match: gi|602034|emb|CAA34729.1| (unnamed protein product [Beta vulgaris subsp. vulgaris])
BLAST of Medtr0049s0100.1 vs. NCBI nr
Match: gi|400639|sp|P15688.2|NU2M_BETVU (RecName: Full=NADH-ubiquinone oxidoreductase chain 2; AltName: Full=NADH dehydrogenase subunit 2 >gi|12822|emb|CAA34728.1| NADH:ubiquinone reductase subunit 2 [Beta vulgaris subsp. vulgaris])
The following BLAST results are available for this feature:
BLAST of Medtr0049s0100.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 3
Match NameE-valueIdentityDescription
gi|9838391|ref|NP_064003.1|5.547970e-1096.15orf300 gene product (mitochondrion) [Beta vulgaris... [more]
gi|602034|emb|CAA34729.1|1.221960e-996.15unnamed protein product [Beta vulgaris subsp. vulg... [more]
gi|400639|sp|P15688.2|NU2M_BETVU1.474610e-996.15RecName: Full=NADH-ubiquinone oxidoreductase chain... [more]
back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
BlastP Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0049s0100.1 ID=Medtr0049s0100.1|Name=Medtr0049s0100.1|organism=Medicago truncatula|type=mRNA|length=186bp
ATGAAGATGGTACGATTCAAAGTGCTTATGAATCGATTCAAACATAGGTC
GGAGAGTTCTGTGAGACGATTCATTCAGAAAAGAGACGATTTAAGTATGA
ATCAATTCTCCGTGCACCGGACACGTAGCTTACCGAATCAGTTGCGACAC
CGATGGGAATGCATGCTACGAAAGATAGGGGTGTGA
back to top