Overview
NameMedtr0049s0090.1
Unique NameMedtr0049s0090.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1077
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0008150 biological_process
biological_process GO:0071554 cell wall organization or biogenesis
biological_process GO:0009987 cellular process
biological_process GO:0071669 plant-type cell wall organization or biogenesis
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0071944 cell periphery
cellular_component GO:0005575 cellular_component
cellular_component GO:0016020 membrane
cellular_component GO:0005886 plasma membrane
molecular_function GO:0019187 beta-1,4-mannosyltransferase activity
molecular_function GO:0003824 catalytic activity
molecular_function GO:0051753 mannan synthase activity
molecular_function GO:0000030 mannosyltransferase activity
molecular_function GO:0003674 molecular_function
molecular_function GO:0016740 transferase activity
molecular_function GO:0016757 transferase activity, transferring glycosyl groups
molecular_function GO:0016758 transferase activity, transferring hexosyl groups
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF03552.963974-64591134-339447-677264.21.5e-82272.37.3e-81

Homology
BLAST of Medtr0049s0090.1 vs. NCBI nr
Match: gi|73665943|gb|AAZ79659.1| (putative cellulose synthase [Fagus sylvatica])
BLAST of Medtr0049s0090.1 vs. NCBI nr
Match: gi|110740025|dbj|BAF01916.1| (cellulose synthase catalytic subunit [Arabidopsis thaliana])
BLAST of Medtr0049s0090.1 vs. NCBI nr
Match: gi|347953837|gb|AEP33544.1| (truncated cellulose synthase catalytic subunit [Gossypium tomentosum])
BLAST of Medtr0049s0090.1 vs. NCBI nr
Match: gi|325464705|gb|ADZ16122.1| (truncated cellulose synthase A3 [Gossypium hirsutum])
BLAST of Medtr0049s0090.1 vs. NCBI nr
Match: gi|347953833|gb|AEP33542.1| (truncated cellulose synthase catalytic subunit [Gossypium darwinii] >gi|347953841|gb|AEP33546.1| truncated cellulose synthase catalytic subunit [Gossypium barbadense var. brasiliense] >gi|347953845|gb|AEP33548.1| truncated cellulose synthase catalytic subunit [Gossypium barbadense var. peruvianum])
BLAST of Medtr0049s0090.1 vs. NCBI nr
Match: gi|347953849|gb|AEP33550.1| (truncated cellulose synthase catalytic subunit [Gossypium hirsutum subsp. latifolium])
BLAST of Medtr0049s0090.1 vs. NCBI nr
Match: gi|502157997|ref|XP_004510986.1| (PREDICTED: cellulose synthase A catalytic subunit 3 [UDP-forming]-like [Cicer arietinum])
BLAST of Medtr0049s0090.1 vs. NCBI nr
Match: gi|162955780|gb|ABY25274.1| (cellulose synthase [Eucalyptus grandis] >gi|629100342|gb|KCW66107.1| hypothetical protein EUGRSUZ_G03380 [Eucalyptus grandis] >gi|629100343|gb|KCW66108.1| hypothetical protein EUGRSUZ_G03380 [Eucalyptus grandis])
BLAST of Medtr0049s0090.1 vs. NCBI nr
Match: gi|590636133|ref|XP_007028786.1| (Cellulose synthase family protein [Theobroma cacao] >gi|508717391|gb|EOY09288.1| Cellulose synthase family protein [Theobroma cacao])
BLAST of Medtr0049s0090.1 vs. NCBI nr
Match: gi|162955786|gb|ABY25277.1| (cellulose synthase [Eucalyptus grandis])
The following BLAST results are available for this feature:
BLAST of Medtr0049s0090.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|73665943|gb|AAZ79659.1|5.093840e-10170.31putative cellulose synthase [Fagus sylvatica][more]
gi|110740025|dbj|BAF01916.1|3.532060e-9767.67cellulose synthase catalytic subunit [Arabidopsis ... [more]
gi|347953837|gb|AEP33544.1|1.851720e-9669.87truncated cellulose synthase catalytic subunit [Go... [more]
gi|325464705|gb|ADZ16122.1|1.994430e-9669.87truncated cellulose synthase A3 [Gossypium hirsutu... [more]
gi|347953833|gb|AEP33542.1|2.037190e-9669.87truncated cellulose synthase catalytic subunit [Go... [more]
gi|347953849|gb|AEP33550.1|2.217580e-9669.87truncated cellulose synthase catalytic subunit [Go... [more]
gi|502157997|ref|XP_004510986.1|3.971750e-9671.18PREDICTED: cellulose synthase A catalytic subunit ... [more]
gi|162955780|gb|ABY25274.1|7.586680e-9669.87cellulose synthase [Eucalyptus grandis] >gi|629100... [more]
gi|590636133|ref|XP_007028786.1|8.339650e-9670.26Cellulose synthase family protein [Theobroma cacao... [more]
gi|162955786|gb|ABY25277.1|1.176030e-9569.87cellulose synthase [Eucalyptus grandis][more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableSEGsegsegcoord: 60..71
score: NAcoord: 92..108
score: NAcoord: 316..327
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0049s0090.1 ID=Medtr0049s0090.1|Name=Medtr0049s0090.1|organism=Medicago truncatula|type=mRNA|length=1077bp
ATGGCCTTAAATGGGAAGCAACTGCGGGAAAGCAGGAACATAGGCAGTAA
ATGGCCGGTCCGAAAATTGCATATGCTTTACTTTTATCATAGGAAATTCT
TATCAAAATTTGTCATAGCTTTGAAGATTACTACCTATGAAGCACGGATA
CGGACACGGACACCGGATACCGGATACGACACGGACAATGACACGTCTAA
CACCGCTAATAATTTGAGAAAATTACATAATTCAGTGCAATTACAAGTGT
CGGTGTCAGACACCGGAACACACCTAATCTTCATAGATTACTACATAAAG
GATGATGATGACATATTGATCAAACCCAGTTGGGTTTCAAGTTACATTGA
CAAATTGTCGAGAAGATCTGATGATGGTCTAGAACAAGATTTACAGGTTA
CTACTTTTGCTGATTCTGCACCTATCAATCTTTCAGATCGTCTAAACCAA
GTGCTTCGATGGGCTTTAGGTTCTGTTGAGGTTCTTTTTAGCCGACATTG
TCCTATCTGGTATGGTTATGGTGGAAGACTAAAGTGGTTTGAAAGGCTTG
CAAATATTTACACCACATTTTATCCACTCATTGTCATTCCCCTTCATATT
AGCAACATAGCAAGTGTATGGTTTATCAACATTGCCAAATTTTTCTTGGA
GATGCGATGGAGCGGTGTTGGAATCGACGAGTGGTGGAGAAACGAACAGT
TTTGGGTGATCGATGGTGTGTTAGCGCACCTTTTTGCCGTGTTCCAAGAC
CAGCTAAAAGTAGTTTTCAGAATCGACACAAACTTTACCTTCACCTTGAA
AGCATCAGATGAAAACGGAGGCTCTGCAGAACTCTACTTGTTCAAATGGA
CAACACTTCTCAATCCTCCAAAGACACTACTCATAATAAATTTGGTAGAA
GTTATTGCTTGTATATCTTATGCCATCAATAATGGTTACCAATCATTGGG
TCTACTCTTTGGTAAACTCTTCTTTGTATTTTGGGTCATCATTCGTCTCT
ACCCTTTCCTTAAAGGTCCTACCGAGTATCATTCATCTCCAAAAAAAAAT
CAATCATCTTATGGGAAATGTCCCTAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0000030mannosyltransferase activity
GO:0003674molecular_function
GO:0003824catalytic activity
GO:0016740transferase activity
GO:0016757transferase activity, transferring glycosyl groups
GO:0016758transferase activity, transferring hexosyl groups
GO:0019187beta-1,4-mannosyltransferase activity
GO:0051753mannan synthase activity
Vocabulary: Cellular Component
TermDefinition
GO:0005886plasma membrane
GO:0005575cellular_component
GO:0016020membrane
GO:0005623cell
GO:0044464cell part
GO:0071944cell periphery
Vocabulary: Biological Process
TermDefinition
GO:0008150biological_process
GO:0009987cellular process
GO:0071554cell wall organization or biogenesis
GO:0071669plant-type cell wall organization or biogenesis