Overview
NameMedtr0049s0070.2
Unique NameMedtr0049s0070.2
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1677
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0008150 biological_process
biological_process GO:0032502 developmental process
cellular_component GO:0005623 cell
cellular_component GO:0005575 cellular_component
molecular_function GO:0003824 catalytic activity
molecular_function GO:0009975 cyclase activity
molecular_function GO:0004383 guanylate cyclase activity
molecular_function GO:0016829 lyase activity
molecular_function GO:0003674 molecular_function
molecular_function GO:0016849 phosphorus-oxygen lyase activity
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00069.2057132-57923241-5044-255143.32.8e-45143.74.9e-42
PF00560.2856580-5664557-781-2114.69.7e-0637.09.6e-10
PF07714.1257132-57932241-5074-259140.32.3e-44140.74e-41
PF12799.256505-5661832-691-3733.21.1e-1151.35.4e-14
PF13516.156574-5664255-771-2312.16.4e-0533.32e-08
PF13855.156580-5675957-1162-6134.16.5e-1239.63e-10

Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0049s0070.2 ID=Medtr0049s0070.2|Name=Medtr0049s0070.2|organism=Medicago truncatula|type=mRNA|length=1677bp
ATGATCACTTGTTCTTCTGATCGTTTCGTCGTTGCTCTTGGAATTCCAAG
CCAGAATATATCAGGTACACTCTCATCAAGCATAGGTTCCTTACCAAACC
TTCAAACTGTGCTGTTGCAGGATAATAATATCACAGGACCAATTCCATCT
GAGATTGGAAAGCTTCAAAAACTTCAAACACTTGATCTTTCTGACAATTT
CTTCACTGGTCAGCTTCCAGATACTCTTTCTCATATGAGGGGTCTCCATT
ATTTGCGGCTAAACAATAACAGTCTTTCTGGACCAATTCCTTCCTCAGTG
GCTAACATGTCACAGCTTGCCTTTCTGGATCTCTCTTTTAATAACTTGAG
TGGACCTGTACCAAGATTAAATGCTAAAACATTCAATATTGTAGGCAATC
CCCAGATATGTGCCACTGGAGGAATTGAGCAAAACTGTTTTAGAACAACA
TTAATTCCTTCTGCTATGAATAATAACTCTCAAGATTTACAATCCTCTAA
TCGACCAAAAAGTCACAAAGCTGCCTTAGCTTTTGCTTCAAGCCTAAGCT
GCATCTGCTTACTAATTCTGGGATTTGGCTTTCTTCTCTGGTGGAGACAA
AGATATAACAAGCAAATATTCTTTGACACGAATGAACAATACCGCGAAGA
GATTTGCCTTGGAAACCTGAAGAAGTTTCATTTCAGAGAACTTCAAGTTT
CTACAAATAACTTCAGCAGCAAAAACTTAGTTGGAAAAGGTGGTTTTGGG
AATGTTTACAAAGGTTGTCTTCGAGATGGTACAGTTATAGCCGTAAAAAG
GCTTAAAGATGGTAATGCAGTTGGTGGTGAGATCCAATTCCAAACTGAAC
TAGAGATGATCAGTTTAGCTGTTCATAGGAATCTTCTTCGCCTCTACGGA
TTTTGCATGACAGCTACGGAGAGGCTCTTAGTATATCCTTATATGTCGAA
TGGTAGTGTCGCTTCTCGTCTCAAAGGCAAGCCAGCTTTAGACTGGGCAA
CAAGGAAGAGAATAGCATTAGGAGCAGGAAGAGGGTTACTATATTTACAT
GAACAGTGTGATCCAAAGATAATTCACAGAGATGTTAAAGCAGCAAATAT
ATTGCTAGATGATTATTGTGAGGCTGTAGTAGGAGACTTTGGATTAGCAA
AACTATTGGACCACAGAGACTCACATGTGACAACAGCAGTGAGAGGAACT
GTAGGACACATAGCCCCTGAATACCTATCAACAGGACAATCCTCAGAGAA
AACAGATGTATTTGGATTTGGAATTCTTCTGCTTGAATTGATTTCTGGAC
AAAGAGCTCTTGAATTTGGGAAAGCTGCTAACCAGAAAGGAGCTATGCTT
GATTGGGTAAAGAAAATACATCAAGAGAAAAAAATTGATGTGTTAGTAGA
CAAGGACTTGAAAAACAAGTATGATAGGATAGAGTTAGATGAAATAGTTC
AAGTGGCTCTTTTATGTACTCAGTACCTTCCAAGTCACAGGCCAAAAATG
TCAGAAGTAGTTAGAATGCTTGAAGGAGATGGACTTGCAGAGAAATGGGA
AGCGTCACAAAGAGCTGAATCAACACGAAGTAGAGGAAATGAACTCTCGT
CTTCAGAACGTTATTCTGATCTTACTGATGACTCTTCTTTGCTTGCACAA
GCAATGGAACTTTCAGGACCAAGATAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: Cellular Component
TermDefinition
GO:0005575cellular_component
GO:0005623cell
Vocabulary: Molecular Function
TermDefinition
GO:0003674molecular_function
GO:0003824catalytic activity
GO:0004383guanylate cyclase activity
GO:0009975cyclase activity
GO:0016829lyase activity
GO:0016849phosphorus-oxygen lyase activity
Vocabulary: Biological Process
TermDefinition
GO:0008150biological_process
GO:0032502developmental process