Overview
NameMedtr0048s0210.1
Unique NameMedtr0048s0210.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length399
Homology
The following BLAST results are available for this feature:
BLAST of Medtr0048s0210.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
BlastP Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0048s0210.1 ID=Medtr0048s0210.1|Name=Medtr0048s0210.1|organism=Medicago truncatula|type=mRNA|length=399bp
ATGATACCCAACTTTAACTACATCTTTCTTTGGCAGGTTAATGTTAAGAG
TCCCACATCGGACAGAACATGGCCTGACAATATGTTTATAAGTGGGGACA
ATTTTCACCTTACAAGTCGGTTTTGTGGGGTTGTGTTAGGCCCAACCACG
ATTTCTAAGATGGTATCAGAGCCTCTCCAAGATCCATTGGACTACCTGTT
ATCAGGTTTCCACATCGAGCCACGCACCATTTATGTCCATGAACCAAGCC
CAATAGTGCTGGTCGTGAGGGGGTGTGTTAAGAGTCCCACATCAGACATG
ACATGGCCTGACAATGTGTATATAAATGGGGGAAATCCTCAAATTACAAA
CCGGTTTTGTGGGGTTGTGTTAGGCCCAACCACAATTTCTAAGAGTTAG
back to top