Overview
NameMedtr0048s0160.1
Unique NameMedtr0048s0160.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length210
Homology
BLAST of Medtr0048s0160.1 vs. NCBI nr
Match: gi|359489025|ref|XP_002279278.2| (PREDICTED: nipped-B-like protein-like [Vitis vinifera])
BLAST of Medtr0048s0160.1 vs. NCBI nr
Match: gi|147767813|emb|CAN77920.1| (hypothetical protein VITISV_027646 [Vitis vinifera])
BLAST of Medtr0048s0160.1 vs. NCBI nr
Match: gi|147865108|emb|CAN79410.1| (hypothetical protein VITISV_038452 [Vitis vinifera])
BLAST of Medtr0048s0160.1 vs. NCBI nr
Match: gi|147791708|emb|CAN64017.1| (hypothetical protein VITISV_031525 [Vitis vinifera])
BLAST of Medtr0048s0160.1 vs. NCBI nr
Match: gi|147858508|emb|CAN81388.1| (hypothetical protein VITISV_015423 [Vitis vinifera])
BLAST of Medtr0048s0160.1 vs. NCBI nr
Match: gi|147838565|emb|CAN67673.1| (hypothetical protein VITISV_036732 [Vitis vinifera])
BLAST of Medtr0048s0160.1 vs. NCBI nr
Match: gi|147800945|emb|CAN75564.1| (hypothetical protein VITISV_032580 [Vitis vinifera])
BLAST of Medtr0048s0160.1 vs. NCBI nr
Match: gi|596029698|ref|XP_007219414.1| (hypothetical protein PRUPE_ppa021915mg, partial [Prunus persica] >gi|462415876|gb|EMJ20613.1| hypothetical protein PRUPE_ppa021915mg, partial [Prunus persica])
BLAST of Medtr0048s0160.1 vs. NCBI nr
Match: gi|147828159|emb|CAN61980.1| (hypothetical protein VITISV_021613 [Vitis vinifera])
BLAST of Medtr0048s0160.1 vs. NCBI nr
Match: gi|147837894|emb|CAN62820.1| (hypothetical protein VITISV_013243 [Vitis vinifera])
The following BLAST results are available for this feature:
BLAST of Medtr0048s0160.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|359489025|ref|XP_002279278.2|3.554830e-850.00PREDICTED: nipped-B-like protein-like [Vitis vinif... [more]
gi|147767813|emb|CAN77920.1|4.468140e-846.15hypothetical protein VITISV_027646 [Vitis vinifera... [more]
gi|147865108|emb|CAN79410.1|6.366870e-850.00hypothetical protein VITISV_038452 [Vitis vinifera... [more]
gi|147791708|emb|CAN64017.1|1.007360e-750.00hypothetical protein VITISV_031525 [Vitis vinifera... [more]
gi|147858508|emb|CAN81388.1|1.074480e-750.00hypothetical protein VITISV_015423 [Vitis vinifera... [more]
gi|147838565|emb|CAN67673.1|1.220900e-750.00hypothetical protein VITISV_036732 [Vitis vinifera... [more]
gi|147800945|emb|CAN75564.1|1.312100e-750.00hypothetical protein VITISV_032580 [Vitis vinifera... [more]
gi|596029698|ref|XP_007219414.1|1.474550e-759.52hypothetical protein PRUPE_ppa021915mg, partial [P... [more]
gi|147828159|emb|CAN61980.1|1.500380e-755.81hypothetical protein VITISV_021613 [Vitis vinifera... [more]
gi|147837894|emb|CAN62820.1|2.746830e-753.49hypothetical protein VITISV_013243 [Vitis vinifera... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
BlastP Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0048s0160.1 ID=Medtr0048s0160.1|Name=Medtr0048s0160.1|organism=Medicago truncatula|type=mRNA|length=210bp
ATGCTCTTTCCTTCTTCAAGGCTTCTTCAGGAGGGTGGAGGGTTGGGGGT
TAGGCAGTTGAGGGAGTTTAATTTAGCTTTGCTAGGGAAATGGTGTTGGC
GGATGTTGATGGACAAAGATAATTTTTGGTATAGAGTGTTGGTGGCGAGA
TATGATGAGGAGGCAGGGAGGTTGGGGGCTAGAGTGTTTCTACTTGGTGG
AGGGAGATAG
back to top