Overview
NameMedtr0048s0110.1
Unique NameMedtr0048s0110.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length195
Homology
BLAST of Medtr0048s0110.1 vs. NCBI nr
Match: gi|502165387|ref|XP_004513557.1| (PREDICTED: uncharacterized protein LOC101501257 [Cicer arietinum])
BLAST of Medtr0048s0110.1 vs. NCBI nr
Match: gi|356517592|ref|XP_003527471.1| (PREDICTED: uncharacterized protein LOC100781575 [Glycine max])
The following BLAST results are available for this feature:
BLAST of Medtr0048s0110.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 2
Match NameE-valueIdentityDescription
gi|502165387|ref|XP_004513557.1|1.825400e-1251.95PREDICTED: uncharacterized protein LOC101501257 [C... [more]
gi|356517592|ref|XP_003527471.1|1.947940e-436.26PREDICTED: uncharacterized protein LOC100781575 [G... [more]
back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
BlastP Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0048s0110.1 ID=Medtr0048s0110.1|Name=Medtr0048s0110.1|organism=Medicago truncatula|type=mRNA|length=195bp
ATGAGGAACTTTTCAAAGAGCAAATTATCTCAATGGTTTCGCCCTGTTGT
TGATCTTCATGAGATACTTGAATCTAAAGTTGTTGCTCACCACTCCAAGA
ACAAACATACAGTTTTAAAAGTGATCAAAGCTATGGTGTTGGAAACTATA
TTGAATAGAAGAGCTCGTCATAAAACTTGTTACGGCTTTGATTAA
back to top