Overview
NameMedtr0048s0090.1
Unique NameMedtr0048s0090.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1707
Homology
BLAST of Medtr0048s0090.1 vs. NCBI nr
Match: gi|502130230|ref|XP_004500576.1| (PREDICTED: uncharacterized protein LOC101500546 [Cicer arietinum])
BLAST of Medtr0048s0090.1 vs. NCBI nr
Match: gi|590689345|ref|XP_007043201.1| (Uncharacterized protein TCM_007660 [Theobroma cacao] >gi|508707136|gb|EOX99032.1| Uncharacterized protein TCM_007660 [Theobroma cacao])
BLAST of Medtr0048s0090.1 vs. NCBI nr
Match: gi|590645987|ref|XP_007031497.1| (PIF1 helicase, putative [Theobroma cacao] >gi|508710526|gb|EOY02423.1| PIF1 helicase, putative [Theobroma cacao])
BLAST of Medtr0048s0090.1 vs. NCBI nr
Match: gi|590653993|ref|XP_007033578.1| (Uncharacterized protein TCM_019749 [Theobroma cacao] >gi|508712607|gb|EOY04504.1| Uncharacterized protein TCM_019749 [Theobroma cacao])
BLAST of Medtr0048s0090.1 vs. NCBI nr
Match: gi|502155583|ref|XP_004510124.1| (PREDICTED: uncharacterized protein LOC101506803 [Cicer arietinum])
BLAST of Medtr0048s0090.1 vs. NCBI nr
Match: gi|89257629|gb|ABD65117.1| (hypothetical protein 31.t00030 [Brassica oleracea])
BLAST of Medtr0048s0090.1 vs. NCBI nr
Match: gi|218200559|gb|EEC82986.1| (hypothetical protein OsI_28021 [Oryza sativa Indica Group])
BLAST of Medtr0048s0090.1 vs. NCBI nr
Match: gi|77551837|gb|ABA94634.1| (AT hook motif-containing protein, putative [Oryza sativa Japonica Group])
BLAST of Medtr0048s0090.1 vs. NCBI nr
Match: gi|77552150|gb|ABA94947.1| (AT hook motif-containing protein, putative [Oryza sativa Japonica Group])
BLAST of Medtr0048s0090.1 vs. NCBI nr
Match: gi|77552439|gb|ABA95236.1| (AT hook motif-containing protein, putative, expressed [Oryza sativa Japonica Group])
The following BLAST results are available for this feature:
BLAST of Medtr0048s0090.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502130230|ref|XP_004500576.1|9.272430e-4442.70PREDICTED: uncharacterized protein LOC101500546 [C... [more]
gi|590689345|ref|XP_007043201.1|7.410000e-4346.86Uncharacterized protein TCM_007660 [Theobroma caca... [more]
gi|590645987|ref|XP_007031497.1|1.104910e-4146.86PIF1 helicase, putative [Theobroma cacao] >gi|5087... [more]
gi|590653993|ref|XP_007033578.1|1.203370e-4146.86Uncharacterized protein TCM_019749 [Theobroma caca... [more]
gi|502155583|ref|XP_004510124.1|4.114310e-4050.00PREDICTED: uncharacterized protein LOC101506803 [C... [more]
gi|89257629|gb|ABD65117.1|5.213620e-4042.54hypothetical protein 31.t00030 [Brassica oleracea][more]
gi|218200559|gb|EEC82986.1|5.272010e-4045.93hypothetical protein OsI_28021 [Oryza sativa Indic... [more]
gi|77551837|gb|ABA94634.1|2.256510e-3948.00AT hook motif-containing protein, putative [Oryza ... [more]
gi|77552150|gb|ABA94947.1|2.566800e-3948.00AT hook motif-containing protein, putative [Oryza ... [more]
gi|77552439|gb|ABA95236.1|2.706740e-3948.00AT hook motif-containing protein, putative, expres... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableSEGsegsegcoord: 346..362
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0048s0090.1 ID=Medtr0048s0090.1|Name=Medtr0048s0090.1|organism=Medicago truncatula|type=mRNA|length=1707bp
ATGTTGCATGTCTTGCACACAGATCCTACTCCAGGGGATCGTACCAGATT
GCATGCAGGGCATATAACTCCTTTGTGTGATGTCACCAATATTTCCAATC
CTACCGACAAAGAAGTTCCATTGCAGAAGATAGGCAACATATTTGATTCT
GCTACCATTCCATATGGCAAGAAGCAGTGTTTCACTCTAGATGGTGTTGC
TATCCGTCCACTCATCTACTGTGCTGGTGATATGCAAGGATCTAACACAG
AGGTAGGACCAGTTCAGCGTCGGCGTCCTTTGCTTCCTGGTAAATACACA
GTTGAAAGGAGCAACCTTATCCATCATGATCAGATCCGCGATAGAGTTAT
TCAATTGTCTAGTTATGAATCTGCTATCAATGATAATGTGTCCGATGAGA
TTGTTTATTGGTCCAATCATAAGGAGCCTTATGTGCCGATTAATCATGGT
ATGATTATATTAATGGTGTACACATTTGTGAAAGTATCGAAAGCTGCAGG
TGCTGCATATGAACCCATACCATATCGATTGCAGTTGCCGGCCTACAAAG
TTTTTCCAGATATTCCATCTTCTTCACCAATAGTCGTTGATCACGGCCTT
GAGTGTAATGACATGGTTTGTAATTTCAATCATGAGGACCCAAATATACG
AATGAATGAAGATAATACGAATGGACAATTTTATGATGCTGATGTCGATA
TATCTGGTGTTCCTGTTAATCAAGGATTCGGATACAGTGACTTGGTCTGT
AGTTGGAATGATGAGGACCCTGATGTACCAATGAATCAAGATAGTGCAGA
TGGAGTATTTTATGATGCTAATGTGGATATCGCTGGCGTACCTGTTAGTC
ATACATTCAGATACACTGACTTGGTTTGTAGTTTAAATGACGAGGACCCT
GATGTACCGACGAATGAAGACGGACAATTCTTGGAGAACAACGTGAATGA
CTCTCATCTACCCGTTAACCCAAATGAAGGAAATGGAGTGCAGCGAATTT
CACTTGCTTTCGGGTGCCAATTCAATGGAGAACAGTCAGATATTTCATCA
TCATCTGGATGGTTTTCTTCTCTTTTTATTTTTTTTGTACACTGGTTGAT
CTCTGTGGATTCAGGTACCGTTGATGAGGATGTTAACGATTTGATTGACA
TCAATGATTCAGGAGGCGAAGAATCTGAATATCTTAATATTGGGGGTCCA
ACATACTTCTGTCAAAAATGTGGTGCAATGATGTGGTATGAGGAACGAGT
TCCCAAGCACACTAGACCTGTAATTCCTCGGTTCTCAATGTGTTGCCTGA
AGGGCAGAGTTGTGCTTCCTCCGTACGAACACCTTCCTCAGTTTCTTCAT
GATATGTACCATAAGCATGATAGAGTTAGCAGATTCTTCATGAATAACAT
CCGGTCTTTCAATAGTATGTTTGCATTCACATCAATGGGAGGGAGAGTCA
ACAACGAACAAAATAATGGGAAAGCACCTCCTATGTTTGTAATGAATGGT
GAAAATTATCACCTGATTGGAAGTTTATTGCCAATGCCTGAAAAACCCCC
CAAGTTTGCGCAACTTTACATCTATCATACTGATAATGAAATCAGCAATA
GAATGGCTGCTGTTAGTATGGATGACGGGCATTTTGATTTGAAGAACATG
ATTATTGGAAATTTAAAAGAATTGCTTGATGAATATAATCCATATGTTCA
GACCTAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated