Overview
NameMedtr0045s0110.1
Unique NameMedtr0045s0110.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1104
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF04862.757671-5671247-3662-322457.79.2e-142458.38.1e-138

Homology
BLAST of Medtr0045s0110.1 vs. NCBI nr
Match: gi|388492964|gb|AFK34548.1| (unknown [Lotus japonicus])
BLAST of Medtr0045s0110.1 vs. NCBI nr
Match: gi|388502164|gb|AFK39148.1| (unknown [Lotus japonicus])
BLAST of Medtr0045s0110.1 vs. NCBI nr
Match: gi|359806626|ref|NP_001241275.1| (uncharacterized protein LOC100796094 precursor [Glycine max] >gi|571514142|ref|XP_006597038.1| PREDICTED: uncharacterized protein LOC100796094 isoform X1 [Glycine max] >gi|255635732|gb|ACU18215.1| unknown [Glycine max])
BLAST of Medtr0045s0110.1 vs. NCBI nr
Match: gi|502128028|ref|XP_004499913.1| (PREDICTED: uncharacterized protein LOC101495888 [Cicer arietinum])
BLAST of Medtr0045s0110.1 vs. NCBI nr
Match: gi|358249172|ref|NP_001239749.1| (uncharacterized protein LOC100804119 precursor [Glycine max] >gi|255645347|gb|ACU23170.1| unknown [Glycine max])
BLAST of Medtr0045s0110.1 vs. NCBI nr
Match: gi|502146124|ref|XP_004506314.1| (PREDICTED: uncharacterized protein LOC101488216 [Cicer arietinum])
BLAST of Medtr0045s0110.1 vs. NCBI nr
Match: gi|356531665|ref|XP_003534397.1| (PREDICTED: uncharacterized protein LOC100812299 [Glycine max])
BLAST of Medtr0045s0110.1 vs. NCBI nr
Match: gi|596001390|ref|XP_007218160.1| (hypothetical protein PRUPE_ppa007461mg [Prunus persica] >gi|462414622|gb|EMJ19359.1| hypothetical protein PRUPE_ppa007461mg [Prunus persica])
BLAST of Medtr0045s0110.1 vs. NCBI nr
Match: gi|225450055|ref|XP_002276894.1| (PREDICTED: uncharacterized protein LOC100258445 [Vitis vinifera])
BLAST of Medtr0045s0110.1 vs. NCBI nr
Match: gi|255553512|ref|XP_002517797.1| (conserved hypothetical protein [Ricinus communis] >gi|223543069|gb|EEF44604.1| conserved hypothetical protein [Ricinus communis])
The following BLAST results are available for this feature:
BLAST of Medtr0045s0110.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|388492964|gb|AFK34548.1|0.000000e+088.83unknown [Lotus japonicus][more]
gi|388502164|gb|AFK39148.1|0.000000e+088.83unknown [Lotus japonicus][more]
gi|359806626|ref|NP_001241275.1|0.000000e+089.10uncharacterized protein LOC100796094 precursor [Gl... [more]
gi|502128028|ref|XP_004499913.1|0.000000e+092.15PREDICTED: uncharacterized protein LOC101495888 [C... [more]
gi|358249172|ref|NP_001239749.1|0.000000e+089.65uncharacterized protein LOC100804119 precursor [Gl... [more]
gi|502146124|ref|XP_004506314.1|0.000000e+079.51PREDICTED: uncharacterized protein LOC101488216 [C... [more]
gi|356531665|ref|XP_003534397.1|0.000000e+078.75PREDICTED: uncharacterized protein LOC100812299 [G... [more]
gi|596001390|ref|XP_007218160.1|0.000000e+072.83hypothetical protein PRUPE_ppa007461mg [Prunus per... [more]
gi|225450055|ref|XP_002276894.1|0.000000e+077.78PREDICTED: uncharacterized protein LOC100258445 [V... [more]
gi|255553512|ref|XP_002517797.1|0.000000e+077.94conserved hypothetical protein [Ricinus communis] ... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableSEGsegsegcoord: 4..23
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0045s0110.1 ID=Medtr0045s0110.1|Name=Medtr0045s0110.1|organism=Medicago truncatula|type=mRNA|length=1104bp
ATGGCGGTGTCTTTCTTTTCTTCAATCTTTCTAGCTTTCTTCTTTGCTTC
TTCAGCTTTTGCTTCTCTTCAGCCTAGAATACCAGAAGTTTATCTTCAAA
ATGGAAACTTTGAGGAGAAGCCAAACCCTAAAGACCTAAAGAATACCAAG
CTCATTGGAAAATTTTCACTACCAAAATGGGAAATCAATGGTTTGGTAGA
GTATGTGACTGGTGGTCCTCAACCAGGAGGCATGTTTTTTCCAGTGACTC
ATGGAACACATGCTGTGAGACTAGGAAATGAAGCTTCAATTTCTCAAACA
ATTAAGGTCAAACCTGGTCAACTCTATGCTTTGATTCTTGGTGCATCAAG
AACTTGTGCACAAGATGAAGTTTTAAGAATCTCCGTGCCTCCACAAACCG
GTGATGTTCCGCTGCAAACATTGTATAGTCTCAATGGTGATGTTATTGCT
TGGGGATTCAAAGCTACATCTAATGTTGCTAAAGTGACTTTTCATAACCC
TGGTGTTCAAGAAGATCCTACTTGTGGTCCACTTCTTGATGCAATTGCTA
TCAGAGAGTTTTACCCTCCAATGCCTACAAGAGTTAATTTGGTGAAAAAT
CCTAGCTTTGAAGAGGGTCCATTCCCAATTTTCAACTCAACCAACGGCGT
TTTACTCCCACCACAACAAGAAGATCTCTACTCACCACTTCCTGGTTGGA
TTGTTGAGTCTCTCAAAGCCGTGAAATTTATCGACTCAAAGCATTTCAAC
GTCCCATTCGGACTTGGAGCAGTTGAGCTTGTTGCCGGCAGAGAAAGCGC
CATTGCACAAATTCTCAGAACAGAAGCTAACAAAGTCTACAAGATCACAT
TCTCAGTCGGAGACGCGAAAAATGGCTGTCACGGATCTATGATGGTTGAA
GCTTTTGCTGCAAAAGATACATTTAAAGTTCCCTTTAAATCCGAAGGGAA
GGGTAAATTCATAACCGTGAGTTTCAAGTTTAAAGCTATCGCACCAAGGA
CTAGACTCACATTCTACAGCTCTTTCTATCATACAAGAATCGATGATTAT
GGTTCTCTCTGTGGTCCTGTTCTTGATCAGGTTATAGTGTCCCCTGTGGC
TTAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated