Overview
NameMedtr0045s0070.2
Unique NameMedtr0045s0070.2
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1347
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0008150 biological_process
biological_process GO:0009058 biosynthetic process
biological_process GO:0008152 metabolic process
biological_process GO:0010025 wax biosynthetic process
biological_process GO:0010166 wax metabolic process
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005622 intracellular
cellular_component GO:0043231 intracellular membrane-bounded organelle
cellular_component GO:0043229 intracellular organelle
cellular_component GO:0044424 intracellular part
cellular_component GO:0043227 membrane-bounded organelle
cellular_component GO:0043226 organelle
molecular_function GO:0003824 catalytic activity
molecular_function GO:0003674 molecular_function
molecular_function GO:0004497 monooxygenase activity
molecular_function GO:0016491 oxidoreductase activity
molecular_function GO:0016705 oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00067.1730793-3195357-44314-429179.36.3e-57179.86.2e-53

Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0045s0070.2 ID=Medtr0045s0070.2|Name=Medtr0045s0070.2|organism=Medicago truncatula|type=mRNA|length=1347bp
ATGGATGCAATTTATATAGGGTGGTTGGGATTAATGATTGGGTTTGTGTT
GTGGTGCTGGAATGAGTGTTGGTATGTTATTCCTCTTAAATTCAAATGCT
TAAAATCTGCTACAAAGTTGCCACCTGGTCATATGGGTTTACCTTTCATT
GGAGAAACAATTAGATTTCTTTGGTACTTCAAAATTGTTAGACGCCCAGA
TGACTTCATTAATGTTAAACGACGCAAATATGGCGACGGGGTAGGAATGT
TTAGGACACACCTCTTTGGAGCACCATCTATCATAGTATACACTCCAACT
GTTAATAAATTTGTGCTATTTTCAGACGATAAGTTCAAACAAGAATGTCC
CACAGTTGAACTTATGGGTCGAACTTCATTGGGGTCTGTCCATGGGAAAG
CCCATACACGGGCCCGAAACTTTGTCACCAATGCCATCAATCGGCCTGAT
GCCCTAAGCCGCATTGCTACTCTTGTTCAACCTCGCATAGTCAATGCTCT
TCAATCTTGGGCACAAATAGGTAAAATTAAAGCCAAGTTTGAAACCCAAA
AGCTGTCATTTGAGAACATTGGGAAATTATTTATGGGCAAGGAGCCAGGC
CCTTTTCTAAATTCCTTGGATAAGCTCTATCAAGGCTTGCTTCCAGGTGT
GAGAGCCTATCCACTTAACATTCCTGGTTTTGCATACCACCATGCTCTTC
AGTGTAGAAGAAAGTTGGAGGACATCTTTTGGATGGAATTAGAGAAAAGA
AAAGCTGAAAATAAGGTTGAAACAAGTGATCTAATGGATGGGTTGATGCA
AATTGAAGATGGTGAAGGTGATAAATTGAGTGACAAAGAAGTTGTAGACA
ACATTGTCTCTCTAGTGGCTGCTGGATATATCCCTACTTCCCTTGCATCA
ACTTGGGCTATTTACCTTCTTGCTAAGTATCCAATTGTGCTAACAAAATT
GAGGGAAGAGAACATCGCTTTCACAAAGGGAAGTTTAGGGGATTTAATTA
CAGCTAAAGATGTTTTGAATTTAAAATACACAAATAAGGTCGTTGATGAG
GTGATAAGAATGGCCAATGTTGCGGCTTTTGTTTTCAGGAAAGCTGCAAA
TGAAGTCGATTATAAAGGTTATAAGATACCAAAGGGATGGAATGTAATTG
TCTTGCTTCGTTATCTTCATACAGACCCAGAGAATTTTAAGGATCCCATG
TATTTCAACCCTGATAGATGGAACGAGCCAGCAATGTCTGGAACATACCA
AGTTTTTGGAGCTGGACAGAGATTATGCCCTGGAAACATGCTTGCGAGAA
TTCAACTTGCACTTCTACTTCATCATTTGTCCATAGGATACAAGTAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: Cellular Component
TermDefinition
GO:0005622intracellular
GO:0005575cellular_component
GO:0005623cell
GO:0043231intracellular membrane-bounded organelle
GO:0043226organelle
GO:0043227membrane-bounded organelle
GO:0043229intracellular organelle
GO:0044424intracellular part
GO:0044464cell part
Vocabulary: Biological Process
TermDefinition
GO:0008152metabolic process
GO:0008150biological_process
GO:0009058biosynthetic process
GO:0010025wax biosynthetic process
GO:0010166wax metabolic process
Vocabulary: Molecular Function
TermDefinition
GO:0003674molecular_function
GO:0003824catalytic activity
GO:0004497monooxygenase activity
GO:0016491oxidoreductase activity
GO:0016705oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen