Overview
NameMedtr0045s0070.1
Unique NameMedtr0045s0070.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1434
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0048856 anatomical structure development
biological_process GO:0008150 biological_process
biological_process GO:0032502 developmental process
biological_process GO:0007275 multicellular organismal development
biological_process GO:0032501 multicellular organismal process
biological_process GO:0043581 mycelium development
biological_process GO:0055114 oxidation-reduction process
biological_process GO:0044707 single-multicellular organism process
biological_process GO:0044767 single-organism developmental process
biological_process GO:0044699 single-organism process
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005622 intracellular
cellular_component GO:0043231 intracellular membrane-bounded organelle
cellular_component GO:0043229 intracellular organelle
cellular_component GO:0044424 intracellular part
cellular_component GO:0043227 membrane-bounded organelle
cellular_component GO:0043226 organelle
molecular_function GO:0018674 (S)-limonene 3-monooxygenase activity
molecular_function GO:0003824 catalytic activity
molecular_function GO:0009055 electron carrier activity
molecular_function GO:0020037 heme binding
molecular_function GO:0005506 iron ion binding
molecular_function GO:0019113 limonene monooxygenase activity
molecular_function GO:0003674 molecular_function
molecular_function GO:0004497 monooxygenase activity
molecular_function GO:0016491 oxidoreductase activity
molecular_function GO:0016705 oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen
molecular_function GO:0016709 oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00067.1730793-3198057-45214-438181.51.4e-57181.91.4e-53

Homology
BLAST of Medtr0045s0070.1 vs. NCBI nr
Match: gi|502128062|ref|XP_004499923.1| (PREDICTED: ent-kaurenoic acid oxidase 2-like, partial [Cicer arietinum])
BLAST of Medtr0045s0070.1 vs. NCBI nr
Match: gi|470130558|ref|XP_004301170.1| (PREDICTED: ent-kaurenoic acid oxidase 1-like [Fragaria vesca subsp. vesca])
BLAST of Medtr0045s0070.1 vs. NCBI nr
Match: gi|595859388|ref|XP_007210937.1| (hypothetical protein PRUPE_ppa025181mg [Prunus persica] >gi|462406672|gb|EMJ12136.1| hypothetical protein PRUPE_ppa025181mg [Prunus persica])
BLAST of Medtr0045s0070.1 vs. NCBI nr
Match: gi|224121554|ref|XP_002318613.1| (predicted protein [Populus trichocarpa])
BLAST of Medtr0045s0070.1 vs. NCBI nr
Match: gi|470130560|ref|XP_004301171.1| (PREDICTED: ent-kaurenoic acid oxidase 2-like [Fragaria vesca subsp. vesca])
BLAST of Medtr0045s0070.1 vs. NCBI nr
Match: gi|326488795|dbj|BAJ98009.1| (predicted protein [Hordeum vulgare subsp. vulgare])
BLAST of Medtr0045s0070.1 vs. NCBI nr
Match: gi|326500762|dbj|BAJ95047.1| (predicted protein [Hordeum vulgare subsp. vulgare])
BLAST of Medtr0045s0070.1 vs. NCBI nr
Match: gi|475491157|gb|EMT03540.1| (Ent-kaurenoic acid oxidase 1 [Aegilops tauschii])
BLAST of Medtr0045s0070.1 vs. NCBI nr
Match: gi|475447969|gb|EMT01609.1| (Ent-kaurenoic acid oxidase 1 [Aegilops tauschii])
BLAST of Medtr0045s0070.1 vs. NCBI nr
Match: gi|357159582|ref|XP_003578492.1| (PREDICTED: ent-kaurenoic acid oxidase 1-like [Brachypodium distachyon])
The following BLAST results are available for this feature:
BLAST of Medtr0045s0070.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502128062|ref|XP_004499923.1|0.000000e+081.84PREDICTED: ent-kaurenoic acid oxidase 2-like, part... [more]
gi|470130558|ref|XP_004301170.1|0.000000e+065.38PREDICTED: ent-kaurenoic acid oxidase 1-like [Frag... [more]
gi|595859388|ref|XP_007210937.1|0.000000e+066.45hypothetical protein PRUPE_ppa025181mg [Prunus per... [more]
gi|224121554|ref|XP_002318613.1|0.000000e+064.29predicted protein [Populus trichocarpa][more]
gi|470130560|ref|XP_004301171.1|0.000000e+063.28PREDICTED: ent-kaurenoic acid oxidase 2-like [Frag... [more]
gi|326488795|dbj|BAJ98009.1|0.000000e+054.73predicted protein [Hordeum vulgare subsp. vulgare][more]
gi|326500762|dbj|BAJ95047.1|0.000000e+054.53predicted protein [Hordeum vulgare subsp. vulgare][more]
gi|475491157|gb|EMT03540.1|2.290590e-17452.55Ent-kaurenoic acid oxidase 1 [Aegilops tauschii][more]
gi|475447969|gb|EMT01609.1|1.168590e-17251.36Ent-kaurenoic acid oxidase 1 [Aegilops tauschii][more]
gi|357159582|ref|XP_003578492.1|2.312470e-16649.51PREDICTED: ent-kaurenoic acid oxidase 1-like [Brac... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR001128Cytochrome P450PRINTSPR00385P450coord: 291..308
score: 1e-06coord: 346..357
score: 1e-06coord: 417..426
score: 1e-06coord: 426..437
score: 1
IPR001128Cytochrome P450GENE3D1.10.630.10no descriptioncoord: 40..476
score: 1
IPR001128Cytochrome P450SUPERFAMILY48264Cytochrome P450coord: 38..476
score: 1.2
IPR002401Cytochrome P450, E-class, group IPRINTSPR00463EP450Icoord: 280..297
score: 6.3e-15coord: 300..326
score: 6.3e-15coord: 345..363
score: 6.3e-15coord: 385..409
score: 6.3e-15coord: 416..426
score: 6.3e-15coord: 426..449
score: 6.3
IPR017972Cytochrome P450, conserved sitePROSITEPS00086CYTOCHROME_P450coord: 419..428
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0045s0070.1 ID=Medtr0045s0070.1|Name=Medtr0045s0070.1|organism=Medicago truncatula|type=mRNA|length=1434bp
ATGGATGCAATTTATATAGGGTGGTTGGGATTAATGATTGGGTTTGTGTT
GTGGTGCTGGAATGAGTGTTGGTATGTTATTCCTCTTAAATTCAAATGCT
TAAAATCTGCTACAAAGTTGCCACCTGGTCATATGGGTTTACCTTTCATT
GGAGAAACAATTAGATTTCTTTGGTACTTCAAAATTGTTAGACGCCCAGA
TGACTTCATTAATGTTAAACGACGCAAATATGGCGACGGGGTAGGAATGT
TTAGGACACACCTCTTTGGAGCACCATCTATCATAGTATACACTCCAACT
GTTAATAAATTTGTGCTATTTTCAGACGATAAGTTCAAACAAGAATGTCC
CACAGTTGAACTTATGGGTCGAACTTCATTGGGGTCTGTCCATGGGAAAG
CCCATACACGGGCCCGAAACTTTGTCACCAATGCCATCAATCGGCCTGAT
GCCCTAAGCCGCATTGCTACTCTTGTTCAACCTCGCATAGTCAATGCTCT
TCAATCTTGGGCACAAATAGGTAAAATTAAAGCCAAGTTTGAAACCCAAA
AGCTGTCATTTGAGAACATTGGGAAATTATTTATGGGCAAGGAGCCAGGC
CCTTTTCTAAATTCCTTGGATAAGCTCTATCAAGGCTTGCTTCCAGGTGT
GAGAGCCTATCCACTTAACATTCCTGGTTTTGCATACCACCATGCTCTTC
AGTGTAGAAGAAAGTTGGAGGACATCTTTTGGATGGAATTAGAGAAAAGA
AAAGCTGAAAATAAGGTTGAAACAAGTGATCTAATGGATGGGTTGATGCA
AATTGAAGATGGTGAAGGTGATAAATTGAGTGACAAAGAAGTTGTAGACA
ACATTGTCTCTCTAGTGGCTGCTGGATATATCCCTACTTCCCTTGCATCA
ACTTGGGCTATTTACCTTCTTGCTAAGTATCCAATTGTGCTAACAAAATT
GAGGGAAGAGAACATCGCTTTCACAAAGGGAAGTTTAGGGGATTTAATTA
CAGCTAAAGATGTTTTGAATTTAAAATACACAAATAAGGTCGTTGATGAG
GTGATAAGAATGGCCAATGTTGCGGCTTTTGTTTTCAGGAAAGCTGCAAA
TGAAGTCGATTATAAAGGTTATAAGATACCAAAGGGATGGAATGTAATTG
TCTTGCTTCGTTATCTTCATACAGACCCAGAGAATTTTAAGGATCCCATG
TATTTCAACCCTGATAGATGGAACGAGCCAGCAATGTCTGGAACATACCA
AGTTTTTGGAGCTGGACAGAGATTATGCCCTGGAAACATGCTTGCGAGAA
TTCAACTTGCACTTCTACTTCATCATTTGTCCATAGGATACAAGTGGGAG
CTTATTAATCCAAACGCAGATATAGTTTATCTTTCACATCCTGCTCCGGT
TGATGGGGTCGAGGTCAAGTTCAGCAGATTGTGA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR001128Cytochrome P450
IPR002401Cytochrome P450, E-class, group I
IPR017972Cytochrome P450, conserved site
Vocabulary: Molecular Function
TermDefinition
GO:0004497monooxygenase activity
GO:0005506iron ion binding
GO:0009055electron carrier activity
GO:0020037heme binding
GO:0003674molecular_function
GO:0003824catalytic activity
GO:0016491oxidoreductase activity
GO:0016705oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen
GO:0016709oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen
GO:0019113limonene monooxygenase activity
GO:0018674(S)-limonene 3-monooxygenase activity
Vocabulary: Biological Process
TermDefinition
GO:0055114oxidation-reduction process
GO:0007275multicellular organismal development
GO:0008150biological_process
GO:0032501multicellular organismal process
GO:0032502developmental process
GO:0043581mycelium development
GO:0044699single-organism process
GO:0044707single-multicellular organism process
GO:0044767single-organism developmental process
GO:0048856anatomical structure development
Vocabulary: Cellular Component
TermDefinition
GO:0005622intracellular
GO:0005575cellular_component
GO:0005623cell
GO:0043231intracellular membrane-bounded organelle
GO:0043226organelle
GO:0043227membrane-bounded organelle
GO:0043229intracellular organelle
GO:0044424intracellular part
GO:0044464cell part