Overview
NameMedtr0042s0230.1
Unique NameMedtr0042s0230.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length468
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0008150 biological_process
biological_process GO:0008152 metabolic process
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005737 cytoplasm
cellular_component GO:0044444 cytoplasmic part
cellular_component GO:0005829 cytosol
cellular_component GO:0005622 intracellular
cellular_component GO:0044424 intracellular part
cellular_component GO:0016020 membrane
molecular_function GO:0003824 catalytic activity
molecular_function GO:0003674 molecular_function
molecular_function GO:0016740 transferase activity
molecular_function GO:0016746 transferase activity, transferring acyl groups
molecular_function GO:0016747 transferase activity, transferring acyl groups other than amino-acyl groups
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF02458.1092058-916367-1471-139138.71.2e-44139.01.3e-40

Homology
BLAST of Medtr0042s0230.1 vs. NCBI nr
Match: gi|224144897|ref|XP_002325454.1| (predicted protein [Populus trichocarpa])
BLAST of Medtr0042s0230.1 vs. NCBI nr
Match: gi|502123231|ref|XP_004498041.1| (PREDICTED: benzyl alcohol O-benzoyltransferase-like [Cicer arietinum])
BLAST of Medtr0042s0230.1 vs. NCBI nr
Match: gi|224126151|ref|XP_002319767.1| (transferase family protein [Populus trichocarpa] >gi|222858143|gb|EEE95690.1| transferase family protein [Populus trichocarpa])
BLAST of Medtr0042s0230.1 vs. NCBI nr
Match: gi|590639859|ref|XP_007029789.1| (Benzoyl coenzyme A: Benzyl alcohol benzoyl transferase [Theobroma cacao] >gi|508718394|gb|EOY10291.1| Benzoyl coenzyme A: Benzyl alcohol benzoyl transferase [Theobroma cacao])
BLAST of Medtr0042s0230.1 vs. NCBI nr
Match: gi|255566066|ref|XP_002524021.1| (transferase, putative [Ricinus communis] >gi|223536748|gb|EEF38389.1| transferase, putative [Ricinus communis])
BLAST of Medtr0042s0230.1 vs. NCBI nr
Match: gi|356500043|ref|XP_003518844.1| (PREDICTED: benzyl alcohol O-benzoyltransferase [Glycine max])
BLAST of Medtr0042s0230.1 vs. NCBI nr
Match: gi|224126147|ref|XP_002319766.1| (hypothetical protein POPTR_0013s07230g [Populus trichocarpa] >gi|222858142|gb|EEE95689.1| hypothetical protein POPTR_0013s07230g [Populus trichocarpa])
BLAST of Medtr0042s0230.1 vs. NCBI nr
Match: gi|590639863|ref|XP_007029790.1| (Benzoyl coenzyme A: Benzyl alcohol benzoyl transferase [Theobroma cacao] >gi|508718395|gb|EOY10292.1| Benzoyl coenzyme A: Benzyl alcohol benzoyl transferase [Theobroma cacao])
BLAST of Medtr0042s0230.1 vs. NCBI nr
Match: gi|590639856|ref|XP_007029788.1| (Benzoyl coenzyme A: Benzyl alcohol benzoyl transferase [Theobroma cacao] >gi|508718393|gb|EOY10290.1| Benzoyl coenzyme A: Benzyl alcohol benzoyl transferase [Theobroma cacao])
BLAST of Medtr0042s0230.1 vs. NCBI nr
Match: gi|502123158|ref|XP_004498016.1| (PREDICTED: benzyl alcohol O-benzoyltransferase-like [Cicer arietinum])
The following BLAST results are available for this feature:
BLAST of Medtr0042s0230.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|224144897|ref|XP_002325454.1|1.220180e-7579.17predicted protein [Populus trichocarpa][more]
gi|502123231|ref|XP_004498041.1|3.820690e-7574.50PREDICTED: benzyl alcohol O-benzoyltransferase-lik... [more]
gi|224126151|ref|XP_002319767.1|1.256560e-7478.47transferase family protein [Populus trichocarpa] >... [more]
gi|590639859|ref|XP_007029789.1|2.332940e-7477.78Benzoyl coenzyme A: Benzyl alcohol benzoyl transfe... [more]
gi|255566066|ref|XP_002524021.1|2.357170e-7474.66transferase, putative [Ricinus communis] >gi|22353... [more]
gi|356500043|ref|XP_003518844.1|8.184750e-7478.23PREDICTED: benzyl alcohol O-benzoyltransferase [Gl... [more]
gi|224126147|ref|XP_002319766.1|1.059370e-7377.93hypothetical protein POPTR_0013s07230g [Populus tr... [more]
gi|590639863|ref|XP_007029790.1|6.418860e-7371.43Benzoyl coenzyme A: Benzyl alcohol benzoyl transfe... [more]
gi|590639856|ref|XP_007029788.1|8.766910e-7376.39Benzoyl coenzyme A: Benzyl alcohol benzoyl transfe... [more]
gi|502123158|ref|XP_004498016.1|2.435130e-7274.83PREDICTED: benzyl alcohol O-benzoyltransferase-lik... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR023213Chloramphenicol acetyltransferase-like domainGENE3D3.30.559.10no descriptioncoord: 7..147
score: 2.7

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0042s0230.1 ID=Medtr0042s0230.1|Name=Medtr0042s0230.1|organism=Medicago truncatula|type=mRNA|length=468bp
ATGGCCCAATCTCTGTTATTCAAAGTCAAGAGGAGTGAACCTGAATTGAT
AAGTCCATCAAAACCCACTCCTCATGAAATAAAACGACTCTCAGACATAG
ATGACCAACAATCTTTACGCTTTCATGTTCCTTTGATACAATTTTACAAC
TATAATCCAATTATGGAAGGCAAAGACCCTGTTGTTGTTATTAGAAAAGC
CCTTGCGAAAACGCTTGTGTTTTATTATCCATTGGCAGGTAGGTTGAGGG
AAGGTCCCGGCAGGAAACTTATGGTTGATTGTACTGGAGAAGGTGTTTTG
TTTATTGAAGCTGATGCTGATGTTACTCTTAAACAATTTGGTGATGCACT
TCATCCTCCATTTCCATGCTTGGGTGAGCTTATCTATGATGTTCCTGGTT
CTTCAGATGTTCTTAACACTCCATTGCTGCTTATTCAGCTTTTGGTCCCT
TCCGTTAAGTTTAATTAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR023213Chloramphenicol acetyltransferase-like domain
Vocabulary: Cellular Component
TermDefinition
GO:0005622intracellular
GO:0005575cellular_component
GO:0016020membrane
GO:0005829cytosol
GO:0005623cell
GO:0005737cytoplasm
GO:0044424intracellular part
GO:0044444cytoplasmic part
GO:0044464cell part
Vocabulary: Biological Process
TermDefinition
GO:0008152metabolic process
GO:0008150biological_process
Vocabulary: Molecular Function
TermDefinition
GO:0003674molecular_function
GO:0003824catalytic activity
GO:0016740transferase activity
GO:0016746transferase activity, transferring acyl groups
GO:0016747transferase activity, transferring acyl groups other than amino-acyl groups