Overview
NameMedtr0042s0130.1
Unique NameMedtr0042s0130.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1029
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF03372.1859382-5889780-24172-25131.21.3e-1131.71.2e-07

Homology
BLAST of Medtr0042s0130.1 vs. NCBI nr
Match: gi|147823314|emb|CAN77450.1| (hypothetical protein VITISV_016971 [Vitis vinifera])
BLAST of Medtr0042s0130.1 vs. NCBI nr
Match: gi|224061791|ref|XP_002300602.1| (predicted protein [Populus trichocarpa])
BLAST of Medtr0042s0130.1 vs. NCBI nr
Match: gi|595883500|ref|XP_007212800.1| (hypothetical protein PRUPE_ppa020180mg [Prunus persica] >gi|462408665|gb|EMJ13999.1| hypothetical protein PRUPE_ppa020180mg [Prunus persica])
BLAST of Medtr0042s0130.1 vs. NCBI nr
Match: gi|147778443|emb|CAN63032.1| (hypothetical protein VITISV_024672 [Vitis vinifera])
BLAST of Medtr0042s0130.1 vs. NCBI nr
Match: gi|242066048|ref|XP_002454313.1| (hypothetical protein SORBIDRAFT_04g028482 [Sorghum bicolor] >gi|241934144|gb|EES07289.1| hypothetical protein SORBIDRAFT_04g028482 [Sorghum bicolor])
BLAST of Medtr0042s0130.1 vs. NCBI nr
Match: gi|596293667|ref|XP_007226707.1| (hypothetical protein PRUPE_ppa020120mg [Prunus persica] >gi|462423643|gb|EMJ27906.1| hypothetical protein PRUPE_ppa020120mg [Prunus persica])
BLAST of Medtr0042s0130.1 vs. NCBI nr
Match: gi|242043564|ref|XP_002459653.1| (hypothetical protein SORBIDRAFT_02g008045 [Sorghum bicolor] >gi|241923030|gb|EER96174.1| hypothetical protein SORBIDRAFT_02g008045 [Sorghum bicolor])
BLAST of Medtr0042s0130.1 vs. NCBI nr
Match: gi|332322141|emb|CCA66050.1| (hypothetical protein [Beta vulgaris subsp. vulgaris])
BLAST of Medtr0042s0130.1 vs. NCBI nr
Match: gi|595967784|ref|XP_007217321.1| (hypothetical protein PRUPE_ppa019733mg [Prunus persica] >gi|462413471|gb|EMJ18520.1| hypothetical protein PRUPE_ppa019733mg [Prunus persica])
BLAST of Medtr0042s0130.1 vs. NCBI nr
Match: gi|595812694|ref|XP_007203452.1| (hypothetical protein PRUPE_ppa022115mg [Prunus persica] >gi|462398983|gb|EMJ04651.1| hypothetical protein PRUPE_ppa022115mg [Prunus persica])
The following BLAST results are available for this feature:
BLAST of Medtr0042s0130.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|147823314|emb|CAN77450.1|5.251240e-6040.98hypothetical protein VITISV_016971 [Vitis vinifera... [more]
gi|224061791|ref|XP_002300602.1|3.384350e-4537.70predicted protein [Populus trichocarpa][more]
gi|595883500|ref|XP_007212800.1|3.427000e-3931.25hypothetical protein PRUPE_ppa020180mg [Prunus per... [more]
gi|147778443|emb|CAN63032.1|5.633990e-3934.94hypothetical protein VITISV_024672 [Vitis vinifera... [more]
gi|242066048|ref|XP_002454313.1|2.890120e-3833.98hypothetical protein SORBIDRAFT_04g028482 [Sorghum... [more]
gi|596293667|ref|XP_007226707.1|5.747830e-3737.56hypothetical protein PRUPE_ppa020120mg [Prunus per... [more]
gi|242043564|ref|XP_002459653.1|6.895490e-3733.06hypothetical protein SORBIDRAFT_02g008045 [Sorghum... [more]
gi|332322141|emb|CCA66050.1|1.186640e-3634.77hypothetical protein [Beta vulgaris subsp. vulgari... [more]
gi|595967784|ref|XP_007217321.1|8.191950e-3634.07hypothetical protein PRUPE_ppa019733mg [Prunus per... [more]
gi|595812694|ref|XP_007203452.1|8.451190e-3633.00hypothetical protein PRUPE_ppa022115mg [Prunus per... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR005135Endonuclease/exonuclease/phosphataseSUPERFAMILY56219DNase I-likecoord: 80..249
score: 9.9
NoneNo IPR availableCOILcoilcoiled-coilcoord: 308..329
score
NoneNo IPR availableGENE3D3.60.10.10no descriptioncoord: 83..246
score: 4.2

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0042s0130.1 ID=Medtr0042s0130.1|Name=Medtr0042s0130.1|organism=Medicago truncatula|type=mRNA|length=1029bp
ATGGTGGATGAACAATTCAAAAATGGCCGAGTCATTACAGACTATTCAAG
GTTGGCCGAGTCACTACGGACTATTCAAGATTGGCCGAGTCCTTACAGAC
TATTCAAAGTTGGCCCTGCCCTCATAGACCCCCTCCTCAACCAGAGACAA
TATGCCTCATTCATTAGTACTTCCCCCAATCATATTAGATTAAACAGGCA
ATGCATTTTTAAACAAAAATCCGCACCTGATAGAGAAGGAAGGGGAGGAG
GTATTGCTTTTCTTTGGAAAAAATATGCAAATTGTACGATAACATATTAC
TCCTTGAATCACATTGATGTAGAAGTCAACGATCCAAGACACGGTAAATG
GAGATTGACAGGCTTTTACGGTTATCCGGAAAGTAGTAGGAGAAAGTCTT
TTTGGAATCTGATCCGGCAACTCTCAATCCTCTCAAATCTCCCTTGGTGT
ATAATTGGTGATTTCAATGACATTTTATCGGCATCTGAGAAGAAAGGTAA
AACAGACAGGGCCCGTTGGCTTATTCAGGGCTTTCGTGATGCTGTCCAGG
ATGCAGGGTTGATTGATTTATTCAAGGAAGGCTATAATTTCACTTGGTTT
AAAAGTCTTGGCACCAGCAGGGCAGTAGAGGAAAAATTAGACAGAGCCTT
GGCAACTGACAGTTGGTTAGCAATGTTCCCAAATGCTAGCCTTGAATGTT
TAACAGCTACTTCGTCTGATCATTATCCACTGAAATTATCATGTGTTGCC
AATAGACAACTATCAGCACAAGGAACTCAGTTTCGGTTCGAGAATTCCTG
GTTACTAGAATCTGAGTTCAAGCCGTTTGTTCAGCAGTGTTGGAATTCTT
GCGCAAATAAAACTATAACCAGCAAGCTTAATTTGTGTGCATCAGAGATG
TTGAATTGGGACAAACAACATGGAAAGCAAACTCGCAACGAGATCGAATC
AGTACGCAGAAAGCTTGAAGCTGCGAGGTCCCAAGTTACGGTGTCCAACT
TCCATTATTTTAACCAGCTTCACAGCTGA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR005135Endonuclease/exonuclease/phosphatase
noIPRunintegrated