Overview
NameMedtr0042s0120.1
Unique NameMedtr0042s0120.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1272
Homology
BLAST of Medtr0042s0120.1 vs. NCBI nr
Match: gi|502102579|ref|XP_004492121.1| (PREDICTED: uncharacterized protein LOC101498022 [Cicer arietinum])
BLAST of Medtr0042s0120.1 vs. NCBI nr
Match: gi|590635177|ref|XP_007028564.1| (Uncharacterized protein TCM_024420 [Theobroma cacao] >gi|508717169|gb|EOY09066.1| Uncharacterized protein TCM_024420 [Theobroma cacao])
BLAST of Medtr0042s0120.1 vs. NCBI nr
Match: gi|89179421|gb|ABD63156.1| (Retrotransposon gag protein [Asparagus officinalis])
BLAST of Medtr0042s0120.1 vs. NCBI nr
Match: gi|502165945|ref|XP_004513739.1| (PREDICTED: uncharacterized protein LOC101502839 [Cicer arietinum])
BLAST of Medtr0042s0120.1 vs. NCBI nr
Match: gi|19881641|gb|AAM01042.1|AC091735_15 (Putative polyprotein [Oryza sativa Japonica Group] >gi|31430941|gb|AAP52786.1| Zinc knuckle family protein [Oryza sativa Japonica Group])
BLAST of Medtr0042s0120.1 vs. NCBI nr
Match: gi|590665339|ref|XP_007036712.1| (Uncharacterized protein TCM_012596 [Theobroma cacao] >gi|508773957|gb|EOY21213.1| Uncharacterized protein TCM_012596 [Theobroma cacao])
BLAST of Medtr0042s0120.1 vs. NCBI nr
Match: gi|110288559|gb|AAP51916.2| (hypothetical protein LOC_Os10g03170 [Oryza sativa Japonica Group])
BLAST of Medtr0042s0120.1 vs. NCBI nr
Match: gi|18997221|gb|AAL83338.1|AC074282_5 (Putative polyprotein [Oryza sativa Japonica Group] >gi|20042899|gb|AAM08727.1|AC116601_20 Putative polyprotein [Oryza sativa Japonica Group])
BLAST of Medtr0042s0120.1 vs. NCBI nr
Match: gi|62734590|gb|AAX96699.1| (Transposable element protein, putative [Oryza sativa Japonica Group] >gi|62734768|gb|AAX96877.1| Transposable element protein, putative [Oryza sativa Japonica Group] >gi|77549720|gb|ABA92517.1| Zinc knuckle family protein [Oryza sativa Japonica Group])
BLAST of Medtr0042s0120.1 vs. NCBI nr
Match: gi|224138666|ref|XP_002322871.1| (predicted protein [Populus trichocarpa])
The following BLAST results are available for this feature:
BLAST of Medtr0042s0120.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502102579|ref|XP_004492121.1|4.607290e-2956.48PREDICTED: uncharacterized protein LOC101498022 [C... [more]
gi|590635177|ref|XP_007028564.1|2.123690e-2835.68Uncharacterized protein TCM_024420 [Theobroma caca... [more]
gi|89179421|gb|ABD63156.1|2.557160e-2842.94Retrotransposon gag protein [Asparagus officinalis... [more]
gi|502165945|ref|XP_004513739.1|5.970280e-2642.49PREDICTED: uncharacterized protein LOC101502839 [C... [more]
gi|19881641|gb|AAM01042.1|AC091735_155.974720e-2633.09Putative polyprotein [Oryza sativa Japonica Group]... [more]
gi|590665339|ref|XP_007036712.1|1.394400e-2230.23Uncharacterized protein TCM_012596 [Theobroma caca... [more]
gi|110288559|gb|AAP51916.2|1.039290e-2126.25hypothetical protein LOC_Os10g03170 [Oryza sativa ... [more]
gi|18997221|gb|AAL83338.1|AC074282_51.269090e-2125.60Putative polyprotein [Oryza sativa Japonica Group]... [more]
gi|62734590|gb|AAX96699.1|5.980320e-2028.42Transposable element protein, putative [Oryza sati... [more]
gi|224138666|ref|XP_002322871.1|6.139820e-2035.37predicted protein [Populus trichocarpa][more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableCOILcoilcoiled-coilcoord: 268..289
score
NoneNo IPR availableSEGsegsegcoord: 177..184
score: NAcoord: 301..316
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0042s0120.1 ID=Medtr0042s0120.1|Name=Medtr0042s0120.1|organism=Medicago truncatula|type=mRNA|length=1272bp
ATGGCTGAACGCACTCTCAAAGAGTACGCTACACCTTCTACGGAAGAGCC
ACAAGCTATTATTGTGTACCCGACGGTTGAGGGTAACAACTTCGAAATCA
AGCCTGCACTACTCAATTTGGTGCAGCAAAATCAGTTTTCTGGATCACCC
ACTGAGGATCCAAATCTCCATATTTCTACCTTCAAAAGACTCAATGGCAC
TATAAAAGAGAACCAAGAAGCCGTAAGACTTCATCTCTTTCCCTTTTCCT
TAAGGGATAGAGCTACCGCTTGGTTCTATTCCCTAGAAGTTGACTCTGTT
GATGCAGCTGCAGGTGGAGCCTTGATGAACAAGAACTATACGGAGGCTTA
CGCTTTGATTGAAGACATGGCTCAGAATCACTACCAATGGACCAACGAAA
GAGCCATCACCGCCTCTACACCCTCTAGAAAAGAGGCAGGTATGTACGAG
GTCTCTTATTATGATCACCTTGCTGCTAAGGTCGATGCACTAACCCAAAA
ATTTGAAAAACATAATGTTAGTGCTGTCACACCTACTCCTACATCTCCTC
CTTGTAAAATTTGTGGTATATTTGGTCATATAGGTGTTGATTGCCAGTTA
GGTAGTGCTGCTAATAGTATTGAGCAAATGAACTATGCTCAATACAACCA
AGGAACGAGGCCAAACCAAAACTTTTATAAAAATCCTCAAGGTTCCTATG
GACAAGTAGCACCACCTGGCTATACAAACAACCAGAGGGTGGCTCAGAAA
TCAAGTTTGGAAATTTTGTTGGAAAATTGCATGATGAATCAAAATAAACA
ACTTAAAGAACTCAAAAATCAAACGGGATTTCTGAACGACTCTCTCTCCA
AACTCAATACCAAGGTAGATTTTATCGCCACACACACTAAAATGCTTGAG
ACCCAAATCTCCCAAGTGGCCCAACAAGTGGCCACCTCTTCTCAAACACC
GGGAGTCTTTCTTGGTCAAACCGAACCCAATCCAAAAGCTCATGTCAATG
CTATTTCTTTTGGGGGTAGTAAGTTACAAGAGACCGTTGCTAAAGCTAAA
ATTACTAAGGGAGAGAATGTTAAGCTTTTAGGTGAGAAATATGTGATAAA
AAGTGAGAAACCACTTGATAAGAACAAAGCCCCTTCCCCATTAAGGCTTG
TTAAGCTTAACTTGGAGGCTCAATTCAATAAATTTGTGAACATGCTTAAA
AAGATTTGCATAAAGATTCCCTTTGCTGAATCTTTGTCTCGTATGCCTCT
ATATGCCAAGTTTTTAAAATAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated