Overview
NameMedtr0042s0100.1
Unique NameMedtr0042s0100.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length627
Homology
BLAST of Medtr0042s0100.1 vs. NCBI nr
Match: gi|590566417|ref|XP_007010227.1| (Uncharacterized protein TCM_043679 [Theobroma cacao] >gi|508727140|gb|EOY19037.1| Uncharacterized protein TCM_043679 [Theobroma cacao])
BLAST of Medtr0042s0100.1 vs. NCBI nr
Match: gi|502165839|ref|XP_004513706.1| (PREDICTED: uncharacterized protein LOC101513458, partial [Cicer arietinum])
BLAST of Medtr0042s0100.1 vs. NCBI nr
Match: gi|502180985|ref|XP_004516732.1| (PREDICTED: uncharacterized protein LOC101506412, partial [Cicer arietinum])
BLAST of Medtr0042s0100.1 vs. NCBI nr
Match: gi|502166188|ref|XP_004513816.1| (PREDICTED: uncharacterized protein LOC101492170, partial [Cicer arietinum])
BLAST of Medtr0042s0100.1 vs. NCBI nr
Match: gi|502165304|ref|XP_004513517.1| (PREDICTED: uncharacterized protein LOC101508110, partial [Cicer arietinum])
BLAST of Medtr0042s0100.1 vs. NCBI nr
Match: gi|356495621|ref|XP_003516673.1| (PREDICTED: uncharacterized protein LOC100801435 [Glycine max])
BLAST of Medtr0042s0100.1 vs. NCBI nr
Match: gi|356551088|ref|XP_003543910.1| (PREDICTED: uncharacterized protein LOC100777299 [Glycine max])
BLAST of Medtr0042s0100.1 vs. NCBI nr
Match: gi|356503764|ref|XP_003520674.1| (PREDICTED: uncharacterized protein LOC100783109 [Glycine max])
BLAST of Medtr0042s0100.1 vs. NCBI nr
Match: gi|356504151|ref|XP_003520862.1| (PREDICTED: uncharacterized protein LOC100811416 [Glycine max])
BLAST of Medtr0042s0100.1 vs. NCBI nr
Match: gi|356495394|ref|XP_003516563.1| (PREDICTED: uncharacterized protein LOC100818308 [Glycine max])
The following BLAST results are available for this feature:
BLAST of Medtr0042s0100.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|590566417|ref|XP_007010227.1|4.238590e-3645.06Uncharacterized protein TCM_043679 [Theobroma caca... [more]
gi|502165839|ref|XP_004513706.1|4.514590e-3655.56PREDICTED: uncharacterized protein LOC101513458, p... [more]
gi|502180985|ref|XP_004516732.1|9.672790e-3655.56PREDICTED: uncharacterized protein LOC101506412, p... [more]
gi|502166188|ref|XP_004513816.1|1.057060e-3555.56PREDICTED: uncharacterized protein LOC101492170, p... [more]
gi|502165304|ref|XP_004513517.1|2.296330e-3545.06PREDICTED: uncharacterized protein LOC101508110, p... [more]
gi|356495621|ref|XP_003516673.1|9.161230e-3353.17PREDICTED: uncharacterized protein LOC100801435 [G... [more]
gi|356551088|ref|XP_003543910.1|9.690280e-3353.17PREDICTED: uncharacterized protein LOC100777299 [G... [more]
gi|356503764|ref|XP_003520674.1|9.962720e-3353.17PREDICTED: uncharacterized protein LOC100783109 [G... [more]
gi|356504151|ref|XP_003520862.1|1.233510e-3253.17PREDICTED: uncharacterized protein LOC100811416 [G... [more]
gi|356495394|ref|XP_003516563.1|2.454510e-3254.03PREDICTED: uncharacterized protein LOC100818308 [G... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableSEGsegsegcoord: 55..62
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0042s0100.1 ID=Medtr0042s0100.1|Name=Medtr0042s0100.1|organism=Medicago truncatula|type=mRNA|length=627bp
ATGGCGAGCAGATGCTTTCACCTCGTGAATATTCCTTTCGGTGAAGCTCT
TGATCAAATGCCTGTCTATGCTAAGTTCATGAAGGTGTTGTTGACTGGAA
GAATAAAACCAAAAGATGATGAAAACATTGCTCTTTCAGAGAATTGTTGT
GCTATTCTCCAAAAGAAACTTCCACCAAAGCTAAAAAATCCAGGTGCCTT
TATTATCCCTTGTTCCATTGGACCGGTAGATATTGGTAGAGCTCTATGTG
ATTTAGGGGCAAGCATCAACTTGATGCCCCTTTCAATGATGAAGAAGCTA
GGATGTGGTGAGCCAAAACCAAAAAGAATGACCCTCACTCTAGCATATCG
GAAGCTGAAAAATCCTAAATGTTACCGAGTTGATGTTGTTGAAGAAATAC
TTGAAGACAATTCCCGTGAACCTCAACCAACACATCCTACGGAAAGAGCA
ATTGTTAATTCTATAGAGAGTTGTGAACATAATGAAGATCTTGAGGGTAA
GGAATGTGTCAAGCAACTGGAGGCAAGCAAGCAAGAGTTGGAACCGGTAA
AAATTGAAGAGATACTTGGTGAAAACTCTATGGGAGCGCCAACTTTGAGT
GCAGAAGGAGAGAAAAATCCAAAATAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated