Overview
NameMedtr0042s0070.1
Unique NameMedtr0042s0070.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length525
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF08743.532118-3172340-1713-15864.65.7e-2265.93.1e-18

Homology
BLAST of Medtr0042s0070.1 vs. NCBI nr
Match: gi|502121669|ref|XP_004497405.1| (PREDICTED: non-structural maintenance of chromosome element 4-like [Cicer arietinum])
BLAST of Medtr0042s0070.1 vs. NCBI nr
Match: gi|356536566|ref|XP_003536808.1| (PREDICTED: non-structural maintenance of chromosomes element 4 homolog A-like [Glycine max])
BLAST of Medtr0042s0070.1 vs. NCBI nr
Match: gi|363807116|ref|NP_001242082.1| (uncharacterized protein LOC100817716 [Glycine max] >gi|255644860|gb|ACU22930.1| unknown [Glycine max])
BLAST of Medtr0042s0070.1 vs. NCBI nr
Match: gi|595824841|ref|XP_007205305.1| (hypothetical protein PRUPE_ppa006782mg [Prunus persica] >gi|462400947|gb|EMJ06504.1| hypothetical protein PRUPE_ppa006782mg [Prunus persica])
BLAST of Medtr0042s0070.1 vs. NCBI nr
Match: gi|225441421|ref|XP_002279026.1| (PREDICTED: non-structural maintenance of chromosome element 4 [Vitis vinifera])
BLAST of Medtr0042s0070.1 vs. NCBI nr
Match: gi|470118026|ref|XP_004295144.1| (PREDICTED: non-structural maintenance of chromosome element 4-like [Fragaria vesca subsp. vesca])
BLAST of Medtr0042s0070.1 vs. NCBI nr
Match: gi|297739846|emb|CBI30028.3| (unnamed protein product [Vitis vinifera])
BLAST of Medtr0042s0070.1 vs. NCBI nr
Match: gi|297746396|emb|CBI16452.3| (unnamed protein product [Vitis vinifera])
BLAST of Medtr0042s0070.1 vs. NCBI nr
Match: gi|413943644|gb|AFW76293.1| (hypothetical protein ZEAMMB73_031879 [Zea mays])
BLAST of Medtr0042s0070.1 vs. NCBI nr
Match: gi|326521484|dbj|BAK00318.1| (predicted protein [Hordeum vulgare subsp. vulgare])
The following BLAST results are available for this feature:
BLAST of Medtr0042s0070.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502121669|ref|XP_004497405.1|4.044810e-7673.46PREDICTED: non-structural maintenance of chromosom... [more]
gi|356536566|ref|XP_003536808.1|1.177650e-5970.50PREDICTED: non-structural maintenance of chromosom... [more]
gi|363807116|ref|NP_001242082.1|5.517600e-5868.31uncharacterized protein LOC100817716 [Glycine max]... [more]
gi|595824841|ref|XP_007205305.1|9.118810e-3944.63hypothetical protein PRUPE_ppa006782mg [Prunus per... [more]
gi|225441421|ref|XP_002279026.1|2.327440e-3641.71PREDICTED: non-structural maintenance of chromosom... [more]
gi|470118026|ref|XP_004295144.1|2.570180e-3643.35PREDICTED: non-structural maintenance of chromosom... [more]
gi|297739846|emb|CBI30028.3|1.127960e-3541.01unnamed protein product [Vitis vinifera][more]
gi|297746396|emb|CBI16452.3|1.647360e-3444.65unnamed protein product [Vitis vinifera][more]
gi|413943644|gb|AFW76293.1|6.428720e-3438.75hypothetical protein ZEAMMB73_031879 [Zea mays][more]
gi|326521484|dbj|BAK00318.1|2.466330e-3345.71predicted protein [Hordeum vulgare subsp. vulgare][more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0042s0070.1 ID=Medtr0042s0070.1|Name=Medtr0042s0070.1|organism=Medicago truncatula|type=mRNA|length=525bp
ATGGCTTGCAGAGGCAACAACAACAAAGAAGAAGAAGTGTTTCGTTGCAT
GAAGAGAGAACGCCCCAACGCCGTCGCCGCGGATGAGGAAGAAGAGGAGC
ATCAGGACTCCAACATTCGCAGAATCATCCGCTCCGAGTTCTTCAAACTC
AAGTCTCTTATCAATGAGAAAAAAGATGATTTAATGAACACTGCTTCGGA
CAAGTTCGATTCAATCCTTCATGACTTCGACAAGTTAGACGAGCAAGTGA
AGAAGCCACAAGAGCAGATTGTTGACGCTGAAGCACTTCTAGATCTGACA
CGCACTCTGGTTGGATCGGTTAACTCTATGGTGAACGAAGGGGTTACTCC
TTCTCAGTTTGTGTCATCTCTCCTCAAACATTATGCTCACCCACCCAACA
CTTCCATTGACTGGCAAAAGCTTGGCATTTTCGTTTCACCCATTTTCCTC
ACTGTTCATGGCTCTTCAACCATGCTTGATCCCATGGAAAGTCAGTTGAA
ACGACGTAAGGCCATTGTGTTGTAA
back to top