Overview
NameMedtr0042s0040.1
Unique NameMedtr0042s0040.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length540
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0008150 biological_process
biological_process GO:0044255 cellular lipid metabolic process
biological_process GO:0044237 cellular metabolic process
biological_process GO:0009987 cellular process
biological_process GO:0006952 defense response
biological_process GO:0033385 geranylgeranyl diphosphate metabolic process
biological_process GO:0006720 isoprenoid metabolic process
biological_process GO:0006629 lipid metabolic process
biological_process GO:0008152 metabolic process
biological_process GO:0071704 organic substance metabolic process
biological_process GO:0019637 organophosphate metabolic process
biological_process GO:0006796 phosphate-containing compound metabolic process
biological_process GO:0006644 phospholipid metabolic process
biological_process GO:0006793 phosphorus metabolic process
biological_process GO:0044238 primary metabolic process
biological_process GO:0050896 response to stimulus
biological_process GO:0006950 response to stress
biological_process GO:0044763 single-organism cellular process
biological_process GO:0044710 single-organism metabolic process
biological_process GO:0044699 single-organism process
biological_process GO:0006721 terpenoid metabolic process
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005737 cytoplasm
cellular_component GO:0044444 cytoplasmic part
cellular_component GO:0005622 intracellular
cellular_component GO:0043231 intracellular membrane-bounded organelle
cellular_component GO:0043229 intracellular organelle
cellular_component GO:0044424 intracellular part
cellular_component GO:0043227 membrane-bounded organelle
cellular_component GO:0043226 organelle
cellular_component GO:0009536 plastid
molecular_function GO:0016835 carbon-oxygen lyase activity
molecular_function GO:0016838 carbon-oxygen lyase activity, acting on phosphates
molecular_function GO:0003824 catalytic activity
molecular_function GO:0016829 lyase activity
molecular_function GO:0003674 molecular_function
molecular_function GO:0010333 terpene synthase activity
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF03936.1112721-12614142-17752-8724.01.3e-0944.21.2e-11

Homology
BLAST of Medtr0042s0040.1 vs. NCBI nr
Match: gi|224066499|ref|XP_002302110.1| (ent-kaurene synthase A family protein [Populus trichocarpa] >gi|222843836|gb|EEE81383.1| ent-kaurene synthase A family protein [Populus trichocarpa])
BLAST of Medtr0042s0040.1 vs. NCBI nr
Match: gi|62005632|dbj|BAD91286.1| (putative copalyl diphosphate synthase [Scoparia dulcis])
BLAST of Medtr0042s0040.1 vs. NCBI nr
Match: gi|511774882|gb|AGN92853.1| (copalyl diphosphate synthase 1 [Malus domestica x Malus honanensis])
BLAST of Medtr0042s0040.1 vs. NCBI nr
Match: gi|658309714|ref|NP_001280948.1| (ent-copalyl diphosphate synthase, chloroplastic [Malus domestica] >gi|476490869|gb|AGI65631.1| ent-copalyl diphosphate synthase [Malus domestica])
BLAST of Medtr0042s0040.1 vs. NCBI nr
Match: gi|595790493|ref|XP_007198995.1| (hypothetical protein PRUPE_ppa002241mg [Prunus persica] >gi|462394395|gb|EMJ00194.1| hypothetical protein PRUPE_ppa002241mg [Prunus persica])
BLAST of Medtr0042s0040.1 vs. NCBI nr
Match: gi|255559426|ref|XP_002520733.1| (Ent-kaurene synthase A, chloroplast precursor, putative [Ricinus communis] >gi|223540118|gb|EEF41695.1| Ent-kaurene synthase A, chloroplast precursor, putative [Ricinus communis])
BLAST of Medtr0042s0040.1 vs. NCBI nr
Match: gi|9651154|dbj|BAB03594.1| (copalyl diphosphate [Scoparia dulcis])
BLAST of Medtr0042s0040.1 vs. NCBI nr
Match: gi|449811539|gb|AGF25267.1| (copalyl diphosphate synthase [Pyrus communis])
BLAST of Medtr0042s0040.1 vs. NCBI nr
Match: gi|590717335|ref|XP_007050589.1| (Copalyl diphosphate synthase [Theobroma cacao] >gi|508702850|gb|EOX94746.1| Copalyl diphosphate synthase [Theobroma cacao])
BLAST of Medtr0042s0040.1 vs. NCBI nr
Match: gi|30519875|dbj|BAC76429.1| (copalyl diphosphate synthase [Cucurbita maxima])
The following BLAST results are available for this feature:
BLAST of Medtr0042s0040.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|224066499|ref|XP_002302110.1|7.047590e-4149.17ent-kaurene synthase A family protein [Populus tri... [more]
gi|62005632|dbj|BAD91286.1|1.048770e-4049.71putative copalyl diphosphate synthase [Scoparia du... [more]
gi|511774882|gb|AGN92853.1|1.747130e-4047.59copalyl diphosphate synthase 1 [Malus domestica x ... [more]
gi|658309714|ref|NP_001280948.1|1.747130e-4047.59ent-copalyl diphosphate synthase, chloroplastic [M... [more]
gi|595790493|ref|XP_007198995.1|1.825260e-4049.16hypothetical protein PRUPE_ppa002241mg [Prunus per... [more]
gi|255559426|ref|XP_002520733.1|2.002570e-4050.88Ent-kaurene synthase A, chloroplast precursor, put... [more]
gi|9651154|dbj|BAB03594.1|2.950060e-4049.16copalyl diphosphate [Scoparia dulcis][more]
gi|449811539|gb|AGF25267.1|5.295660e-4047.59copalyl diphosphate synthase [Pyrus communis][more]
gi|590717335|ref|XP_007050589.1|1.551220e-3949.21Copalyl diphosphate synthase [Theobroma cacao] >gi... [more]
gi|30519875|dbj|BAC76429.1|3.637190e-3948.89copalyl diphosphate synthase [Cucurbita maxima][more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR008949Terpenoid synthaseGENE3D1.10.600.10no descriptioncoord: 101..139
score: 2.4
IPR008949Terpenoid synthaseSUPERFAMILY48576Terpenoid synthasescoord: 114..166
score: 7.6

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0042s0040.1 ID=Medtr0042s0040.1|Name=Medtr0042s0040.1|organism=Medicago truncatula|type=mRNA|length=540bp
ATGACGTCATCAGAAGCAGAAGTTCATCAGAAGCAGAAGACCATCAGAAG
CAAGATTTCATCAGAAGCTATATCATCACCAGAAGCTACAAATTCTCAAG
TGCTATTTCAAGAGAAGATTCTTGAAGATGCCAAGAATTTTTCAGCCAAG
TATTTAAAAAAGAAACGTGCTGCTAATGAGCTCTTAGATAAATGGATCAT
AACCAATGATTTACCTGGCAAGCAAACACTCTACAGCTGTGGGTTATGCT
CTGGATGTCATGGTATGCTAGCTTACCCAGATTACGGTGGTGAAAATGAT
GTTTGGATTGGCAAGACCCTTTACAGGATGCCGTACATGACCAATGATGT
TTATCTTGAGCTTGCAAAGTTGGATTACAACAATTGTCAAGCAATGCATT
ATGATGAATGGAAAGAAGAAATCCAAAGCATATTTGAGCCTGAGAGGTCT
CTAGAGAGACTTGCATGGGCAAAAACAACAGCTTTGCTTCAAATACTGGA
GTCGAATTTCAAAGATGAAGAAACTAGGAAGGGTTTGTAG
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR008949Terpenoid synthase
Vocabulary: Cellular Component
TermDefinition
GO:0005622intracellular
GO:0005575cellular_component
GO:0005623cell
GO:0005737cytoplasm
GO:0043231intracellular membrane-bounded organelle
GO:0009536plastid
GO:0043226organelle
GO:0043227membrane-bounded organelle
GO:0043229intracellular organelle
GO:0044424intracellular part
GO:0044444cytoplasmic part
GO:0044464cell part
Vocabulary: Biological Process
TermDefinition
GO:0008152metabolic process
GO:0006952defense response
GO:0006629lipid metabolic process
GO:0006644phospholipid metabolic process
GO:0006720isoprenoid metabolic process
GO:0006721terpenoid metabolic process
GO:0006793phosphorus metabolic process
GO:0006796phosphate-containing compound metabolic process
GO:0006950response to stress
GO:0008150biological_process
GO:0009987cellular process
GO:0019637organophosphate metabolic process
GO:0033385geranylgeranyl diphosphate metabolic process
GO:0044237cellular metabolic process
GO:0044238primary metabolic process
GO:0044255cellular lipid metabolic process
GO:0044699single-organism process
GO:0044710single-organism metabolic process
GO:0044763single-organism cellular process
GO:0050896response to stimulus
GO:0071704organic substance metabolic process
Vocabulary: Molecular Function
TermDefinition
GO:0003674molecular_function
GO:0003824catalytic activity
GO:0010333terpene synthase activity
GO:0016829lyase activity
GO:0016835carbon-oxygen lyase activity
GO:0016838carbon-oxygen lyase activity, acting on phosphates