Overview
NameMedtr0041s0140.1
Unique NameMedtr0041s0140.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length757
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0065007 biological regulation
biological_process GO:0008150 biological_process
biological_process GO:0055080 cation homeostasis
biological_process GO:0030003 cellular cation homeostasis
biological_process GO:0055082 cellular chemical homeostasis
biological_process GO:0019725 cellular homeostasis
biological_process GO:0006873 cellular ion homeostasis
biological_process GO:0006875 cellular metal ion homeostasis
biological_process GO:0009987 cellular process
biological_process GO:0046916 cellular transition metal ion homeostasis
biological_process GO:0048878 chemical homeostasis
biological_process GO:0042592 homeostatic process
biological_process GO:0050801 ion homeostasis
biological_process GO:0055065 metal ion homeostasis
biological_process GO:0030001 metal ion transport
biological_process GO:0065008 regulation of biological quality
biological_process GO:0044763 single-organism cellular process
biological_process GO:0044699 single-organism process
biological_process GO:0055076 transition metal ion homeostasis
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005737 cytoplasm
cellular_component GO:0005622 intracellular
cellular_component GO:0043231 intracellular membrane-bounded organelle
cellular_component GO:0043229 intracellular organelle
cellular_component GO:0044424 intracellular part
cellular_component GO:0043227 membrane-bounded organelle
cellular_component GO:0005634 nucleus
cellular_component GO:0043226 organelle
molecular_function GO:0005488 binding
molecular_function GO:0043169 cation binding
molecular_function GO:0043167 ion binding
molecular_function GO:0046872 metal ion binding
molecular_function GO:0003674 molecular_function
molecular_function GO:0046914 transition metal ion binding
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00403.21111122-111295134-1913-5646.02.8e-1693.55.8e-27

Homology
BLAST of Medtr0041s0140.1 vs. NCBI nr
Match: gi|502111232|ref|XP_004493993.1| (PREDICTED: microtubule-associated protein 1B-like [Cicer arietinum])
BLAST of Medtr0041s0140.1 vs. NCBI nr
Match: gi|356570770|ref|XP_003553557.1| (PREDICTED: neurofilament medium polypeptide-like [Glycine max])
BLAST of Medtr0041s0140.1 vs. NCBI nr
Match: gi|356505250|ref|XP_003521405.1| (PREDICTED: heterogeneous nuclear ribonucleoprotein D-like [Glycine max])
BLAST of Medtr0041s0140.1 vs. NCBI nr
Match: gi|413968366|gb|AFW90521.1| (hypothetical protein [Phaseolus vulgaris])
BLAST of Medtr0041s0140.1 vs. NCBI nr
Match: gi|388495726|gb|AFK35929.1| (unknown [Lotus japonicus])
BLAST of Medtr0041s0140.1 vs. NCBI nr
Match: gi|590630905|ref|XP_007027412.1| (Heavy metal transport/detoxification superfamily protein, putative [Theobroma cacao] >gi|508716017|gb|EOY07914.1| Heavy metal transport/detoxification superfamily protein, putative [Theobroma cacao])
BLAST of Medtr0041s0140.1 vs. NCBI nr
Match: gi|502122009|ref|XP_004497534.1| (PREDICTED: axoneme-associated protein mst101(2)-like [Cicer arietinum])
BLAST of Medtr0041s0140.1 vs. NCBI nr
Match: gi|470137413|ref|XP_004304460.1| (PREDICTED: uncharacterized protein LOC101296693 [Fragaria vesca subsp. vesca])
BLAST of Medtr0041s0140.1 vs. NCBI nr
Match: gi|356533189|ref|XP_003535150.1| (PREDICTED: copper-transporting ATPase 2-like [Glycine max])
BLAST of Medtr0041s0140.1 vs. NCBI nr
Match: gi|388491194|gb|AFK33663.1| (unknown [Lotus japonicus])
The following BLAST results are available for this feature:
BLAST of Medtr0041s0140.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502111232|ref|XP_004493993.1|2.081580e-9672.97PREDICTED: microtubule-associated protein 1B-like ... [more]
gi|356570770|ref|XP_003553557.1|7.280540e-7364.22PREDICTED: neurofilament medium polypeptide-like [... [more]
gi|356505250|ref|XP_003521405.1|1.316200e-7260.48PREDICTED: heterogeneous nuclear ribonucleoprotein... [more]
gi|413968366|gb|AFW90521.1|2.942250e-6957.96hypothetical protein [Phaseolus vulgaris][more]
gi|388495726|gb|AFK35929.1|8.439920e-6455.98unknown [Lotus japonicus][more]
gi|590630905|ref|XP_007027412.1|6.551930e-6151.49Heavy metal transport/detoxification superfamily p... [more]
gi|502122009|ref|XP_004497534.1|9.871250e-6152.53PREDICTED: axoneme-associated protein mst101(2)-li... [more]
gi|470137413|ref|XP_004304460.1|1.277030e-5746.57PREDICTED: uncharacterized protein LOC101296693 [F... [more]
gi|356533189|ref|XP_003535150.1|9.269830e-5749.42PREDICTED: copper-transporting ATPase 2-like [Glyc... [more]
gi|388491194|gb|AFK33663.1|1.587140e-5651.59unknown [Lotus japonicus][more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR006121Heavy metal transport/detoxification proteinPROFILEPS50846HMA_2coord: 21..69
score: 9
IPR006121Heavy metal transport/detoxification proteinSUPERFAMILY55008HMA, heavy metal-associated domaincoord: 8..80
score: 2.2e-12coord: 124..196
score: 5.2
NoneNo IPR availableGENE3D3.30.70.100no descriptioncoord: 16..76
score: 1.9e-11coord: 128..184
score: 1.8
NoneNo IPR availableSEGsegsegcoord: 83..94
score: NAcoord: 96..121
score: NAcoord: 143..154
score: NAcoord: 204..228
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0041s0140.1 ID=Medtr0041s0140.1|Name=Medtr0041s0140.1|organism=Medicago truncatula|type=mRNA|length=757bp
ATGGGTCAGAAAGATGAGATGAAAAACGACGATATCCCTTCTGTCGTTTT
GAAACTGGACTTACATTGCGAAGGATGCGTGAAGAAGATCAAACGCGCGG
TTCGCCATTTCGACGGTGTGGAAGACGTTAAGGCAGATACGCCAAATAAC
AAATTAACCGTTATTGGAAAAGTAGATCCTCACAAGGTTCGTGATAAACT
GGCGGAGAAAATTAAGAAGAAGGTTGAGCTTGTTTCCTCCCCTCAGCCTA
AAAAAGACGACCCCGCTGCAGCCGATAAACCGCAGGAGAAGAAGAATCAC
GATGAGGAGAAGAAGAAACCGGACGAAGACAAAAAACCTGAGGAGAAAAA
ACCCGAAGAAAAATCCTCAAAACAGTCGGTTCAAAACACGGTCGTTTTGA
AGATTAGATTGCATTGCGATGGTTGTATTCAAAAAATTGAAAAGATTATC
CTCAAAATCAAAGGAGTCGAATCAGTGACAAGTGATGAAGGGAAGGATTT
GGTGACGGTAAAAGGAACGATAGATGCAAAGGAAATTGTACCATATCTGG
CGGAGAAGCTGAAGCGGAATGTGGATGTGGTTCAACCAAAGAAAGAGGAT
GGTAAGAATAAAGAGAAAGATCAAAGTGGTGGTGAGAAGAAAGAGGGAGA
AAAAGCAAAGGAAGTCGGAACTAAGGTAGAGGTTAATAAAATGGAGCATC
ATGGTTATGGATATGGGCATCAAACTCCTATGTATTGGTATGACGGATAT
GAACCGG
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR006121Heavy metal transport/detoxification protein
noIPRunintegrated
Vocabulary: Biological Process
TermDefinition
GO:0030001metal ion transport
GO:0006873cellular ion homeostasis
GO:0006875cellular metal ion homeostasis
GO:0008150biological_process
GO:0009987cellular process
GO:0019725cellular homeostasis
GO:0030003cellular cation homeostasis
GO:0042592homeostatic process
GO:0044699single-organism process
GO:0044763single-organism cellular process
GO:0050801ion homeostasis
GO:0046916cellular transition metal ion homeostasis
GO:0048878chemical homeostasis
GO:0055065metal ion homeostasis
GO:0055076transition metal ion homeostasis
GO:0055080cation homeostasis
GO:0055082cellular chemical homeostasis
GO:0065007biological regulation
GO:0065008regulation of biological quality
Vocabulary: Molecular Function
TermDefinition
GO:0046872metal ion binding
GO:0003674molecular_function
GO:0005488binding
GO:0043167ion binding
GO:0043169cation binding
GO:0046914transition metal ion binding
Vocabulary: Cellular Component
TermDefinition
GO:0005622intracellular
GO:0005575cellular_component
GO:0005623cell
GO:0005634nucleus
GO:0005737cytoplasm
GO:0043231intracellular membrane-bounded organelle
GO:0043226organelle
GO:0043227membrane-bounded organelle
GO:0043229intracellular organelle
GO:0044424intracellular part
GO:0044464cell part