Overview
NameMedtr0041s0130.1
Unique NameMedtr0041s0130.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length435
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0048856 anatomical structure development
biological_process GO:0008150 biological_process
biological_process GO:0032502 developmental process
biological_process GO:0007275 multicellular organismal development
biological_process GO:0032501 multicellular organismal process
biological_process GO:0043581 mycelium development
biological_process GO:0044707 single-multicellular organism process
biological_process GO:0044767 single-organism developmental process
biological_process GO:0044699 single-organism process
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0071944 cell periphery
cellular_component GO:0009986 cell surface
cellular_component GO:0005575 cellular_component
cellular_component GO:0016020 membrane
cellular_component GO:0005886 plasma membrane
molecular_function GO:0005488 binding
molecular_function GO:0003674 molecular_function
molecular_function GO:0005515 protein binding
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF02359.13108554-10880231-1131-8687.82.2e-2988.32.1e-25

Homology
BLAST of Medtr0041s0130.1 vs. NCBI nr
Match: gi|502111218|ref|XP_004493989.1| (PREDICTED: cell division control protein 48 homolog D-like isoform X2 [Cicer arietinum])
BLAST of Medtr0041s0130.1 vs. NCBI nr
Match: gi|502111215|ref|XP_004493988.1| (PREDICTED: cell division control protein 48 homolog D-like isoform X1 [Cicer arietinum])
BLAST of Medtr0041s0130.1 vs. NCBI nr
Match: gi|356505246|ref|XP_003521403.1| (PREDICTED: cell division cycle protein 48 homolog [Glycine max])
BLAST of Medtr0041s0130.1 vs. NCBI nr
Match: gi|356548285|ref|XP_003542533.1| (PREDICTED: cell division cycle protein 48 homolog [Glycine max])
BLAST of Medtr0041s0130.1 vs. NCBI nr
Match: gi|502121999|ref|XP_004497529.1| (PREDICTED: cell division cycle protein 48 homolog [Cicer arietinum])
BLAST of Medtr0041s0130.1 vs. NCBI nr
Match: gi|502111221|ref|XP_004493990.1| (PREDICTED: cell division control protein 48 homolog D-like isoform X3 [Cicer arietinum])
BLAST of Medtr0041s0130.1 vs. NCBI nr
Match: gi|449440119|ref|XP_004137832.1| (PREDICTED: cell division cycle protein 48 homolog [Cucumis sativus] >gi|449525650|ref|XP_004169829.1| PREDICTED: cell division cycle protein 48 homolog [Cucumis sativus])
BLAST of Medtr0041s0130.1 vs. NCBI nr
Match: gi|356533213|ref|XP_003535161.1| (PREDICTED: cell division cycle protein 48 homolog [Glycine max])
BLAST of Medtr0041s0130.1 vs. NCBI nr
Match: gi|356572464|ref|XP_003554388.1| (PREDICTED: cell division cycle protein 48 homolog [Glycine max])
BLAST of Medtr0041s0130.1 vs. NCBI nr
Match: gi|590630806|ref|XP_007027382.1| (ATPase, AAA-type, CDC48 protein isoform 2 [Theobroma cacao] >gi|508715987|gb|EOY07884.1| ATPase, AAA-type, CDC48 protein isoform 2 [Theobroma cacao])
The following BLAST results are available for this feature:
BLAST of Medtr0041s0130.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502111218|ref|XP_004493989.1|1.985270e-8897.22PREDICTED: cell division control protein 48 homolo... [more]
gi|502111215|ref|XP_004493988.1|3.888640e-8897.22PREDICTED: cell division control protein 48 homolo... [more]
gi|356505246|ref|XP_003521403.1|4.595260e-8795.83PREDICTED: cell division cycle protein 48 homolog ... [more]
gi|356548285|ref|XP_003542533.1|5.139840e-8795.14PREDICTED: cell division cycle protein 48 homolog ... [more]
gi|502121999|ref|XP_004497529.1|8.602460e-8795.14PREDICTED: cell division cycle protein 48 homolog ... [more]
gi|502111221|ref|XP_004493990.1|3.094530e-8695.83PREDICTED: cell division control protein 48 homolo... [more]
gi|449440119|ref|XP_004137832.1|4.154580e-8693.75PREDICTED: cell division cycle protein 48 homolog ... [more]
gi|356533213|ref|XP_003535161.1|8.530900e-8695.21PREDICTED: cell division cycle protein 48 homolog ... [more]
gi|356572464|ref|XP_003554388.1|3.574510e-8594.44PREDICTED: cell division cycle protein 48 homolog ... [more]
gi|590630806|ref|XP_007027382.1|3.854270e-8490.97ATPase, AAA-type, CDC48 protein isoform 2 [Theobro... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR009010Aspartate decarboxylase-like foldGENE3D2.40.40.20no descriptioncoord: 27..113
score: 2.5
IPR009010Aspartate decarboxylase-like foldSUPERFAMILY50692ADC-likecoord: 27..112
score: 1.1
NoneNo IPR availableGENE3D3.10.330.10no descriptioncoord: 115..142
score: 1.6
NoneNo IPR availableSUPERFAMILY54585Cdc48 domain 2-likecoord: 113..144
score: 8.9

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0041s0130.1 ID=Medtr0041s0130.1|Name=Medtr0041s0130.1|organism=Medicago truncatula|type=mRNA|length=435bp
ATGGCGAATCAACCCGAATCCTCCGATGCTAAGGGAACTACAAAAAGAGA
TTTCAGCACTGCAATTCTCGAACGCAAAAAAGCCCCAAATCGTTTGGTTG
TTGATGAAGCTGTTAACGATGACAACTCCGTCGTCGCTCTTCATCCCGAG
ACTATGGAAAAGCTTCAACTATTCCGCGGTGACACTATCTTGATCAAGGG
TAAGAAAAGGAAAGATACTATATGTATTGCACTCGCTGATGAAACATGTG
AAGAGCCAAAAATAAGAATGAACAAGGTTGTGAGGAACAATCTTAGGGTT
AGGCTTGGAGATGTTGTTTCGGTGCATCAATGTGCTGATGTCAAATATGG
AAAGAGAGTTCACATTCTTCCCGTCGATGATACTATTGAAGGAGTTACTG
GGAATCTCTTTGATGCATACTTAAAACGCTGGTAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR009010Aspartate decarboxylase-like fold
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0005488binding
GO:0005515protein binding
GO:0003674molecular_function
Vocabulary: Cellular Component
TermDefinition
GO:0005886plasma membrane
GO:0005575cellular_component
GO:0016020membrane
GO:0005623cell
GO:0009986cell surface
GO:0044464cell part
GO:0071944cell periphery
Vocabulary: Biological Process
TermDefinition
GO:0007275multicellular organismal development
GO:0008150biological_process
GO:0032501multicellular organismal process
GO:0032502developmental process
GO:0043581mycelium development
GO:0044699single-organism process
GO:0044707single-multicellular organism process
GO:0044767single-organism developmental process
GO:0048856anatomical structure development