Overview
NameMedtr0041s0110.1
Unique NameMedtr0041s0110.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1947
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
molecular_function GO:0003677 DNA binding
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF02362.1687718-88023131-2321-9568.93.1e-2370.28.4e-20
PF06507.888237-88482304-3852-8393.85.6e-3195.21.4e-27

Homology
BLAST of Medtr0041s0110.1 vs. NCBI nr
Match: gi|590630648|ref|XP_007027336.1| (Auxin response factor 19 [Theobroma cacao] >gi|508715941|gb|EOY07838.1| Auxin response factor 19 [Theobroma cacao])
BLAST of Medtr0041s0110.1 vs. NCBI nr
Match: gi|595840619|ref|XP_007208053.1| (hypothetical protein PRUPE_ppa002195mg [Prunus persica] >gi|462403695|gb|EMJ09252.1| hypothetical protein PRUPE_ppa002195mg [Prunus persica])
BLAST of Medtr0041s0110.1 vs. NCBI nr
Match: gi|356537563|ref|XP_003537296.1| (PREDICTED: auxin response factor 18-like isoform X1 [Glycine max] >gi|571481827|ref|XP_006588784.1| PREDICTED: auxin response factor 18-like isoform X2 [Glycine max])
BLAST of Medtr0041s0110.1 vs. NCBI nr
Match: gi|658309370|ref|NP_001280997.1| (auxin response factor 18-like [Malus domestica] >gi|206572097|gb|ACI13681.1| putative auxin response factor ARF16 [Malus domestica])
BLAST of Medtr0041s0110.1 vs. NCBI nr
Match: gi|470137364|ref|XP_004304436.1| (PREDICTED: auxin response factor 18-like [Fragaria vesca subsp. vesca])
BLAST of Medtr0041s0110.1 vs. NCBI nr
Match: gi|356570756|ref|XP_003553551.1| (PREDICTED: auxin response factor 18-like [Glycine max])
BLAST of Medtr0041s0110.1 vs. NCBI nr
Match: gi|460402311|ref|XP_004246657.1| (PREDICTED: auxin response factor 18-like [Solanum lycopersicum])
BLAST of Medtr0041s0110.1 vs. NCBI nr
Match: gi|255556996|ref|XP_002519531.1| (Auxin response factor, putative [Ricinus communis] >gi|223541394|gb|EEF42945.1| Auxin response factor, putative [Ricinus communis])
BLAST of Medtr0041s0110.1 vs. NCBI nr
Match: gi|449482590|ref|XP_004156337.1| (PREDICTED: auxin response factor 18-like [Cucumis sativus])
BLAST of Medtr0041s0110.1 vs. NCBI nr
Match: gi|449451004|ref|XP_004143252.1| (PREDICTED: auxin response factor 18-like [Cucumis sativus])
The following BLAST results are available for this feature:
BLAST of Medtr0041s0110.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|590630648|ref|XP_007027336.1|0.000000e+053.39Auxin response factor 19 [Theobroma cacao] >gi|508... [more]
gi|595840619|ref|XP_007208053.1|0.000000e+059.03hypothetical protein PRUPE_ppa002195mg [Prunus per... [more]
gi|356537563|ref|XP_003537296.1|0.000000e+057.84PREDICTED: auxin response factor 18-like isoform X... [more]
gi|658309370|ref|NP_001280997.1|0.000000e+058.88auxin response factor 18-like [Malus domestica] >g... [more]
gi|470137364|ref|XP_004304436.1|0.000000e+056.43PREDICTED: auxin response factor 18-like [Fragaria... [more]
gi|356570756|ref|XP_003553551.1|0.000000e+056.43PREDICTED: auxin response factor 18-like [Glycine ... [more]
gi|460402311|ref|XP_004246657.1|0.000000e+053.19PREDICTED: auxin response factor 18-like [Solanum ... [more]
gi|255556996|ref|XP_002519531.1|0.000000e+055.14Auxin response factor, putative [Ricinus communis]... [more]
gi|449482590|ref|XP_004156337.1|0.000000e+053.14PREDICTED: auxin response factor 18-like [Cucumis ... [more]
gi|449451004|ref|XP_004143252.1|0.000000e+053.14PREDICTED: auxin response factor 18-like [Cucumis ... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR003340Transcriptional factor B3PROFILEPS50863B3coord: 131..233
score: 12
IPR015300DNA-binding pseudobarrel domainGENE3D2.40.330.10no descriptioncoord: 122..237
score: 2.1
IPR015300DNA-binding pseudobarrel domainSUPERFAMILY101936DNA-binding pseudobarrel domaincoord: 114..237
score: 3.7
NoneNo IPR availableSEGsegsegcoord: 17..28
score: NAcoord: 421..432
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0041s0110.1 ID=Medtr0041s0110.1|Name=Medtr0041s0110.1|organism=Medicago truncatula|type=mRNA|length=1947bp
ATGAAAGAAAAGAGAAAAGGTTGCAGTCCAACTGAGATGAATATGGAGTC
AAAGAAGAAATTGAAAAATGTGAACAAGAGTGTGGACCCTCAGCTATGGC
ATGCCGTTGCAGGAGGAATGGTTCAAATGCCAGAAGTTAACTCACAGGTC
TTCTACTTCCCTCAGGGTCACGCCGAGCATGCTTGTGAGCCTGTGAATTT
CAGTTCTTACTCCAAAATTCCGTCTTTCATTCCATGTAGAGTTGAAGCTA
TAAGATATATGGCTAATCATGAGACCGATGAAGTGTATGCAAAACTCAGA
CTTGTCCCTATGAATATTAACCAGGTTAGTTTTGATAATGATGGTGTTGC
TGGCATCAACGTGTCCGAAACAAAGGATAAACATCAATCTTTTGCGAAAA
CCTTGACACAATCTGATGCAAACAATGGTGGTGGCTTTTCTTGTCCTAGA
TATTGTGCAGAAACGCTTTTTCCTCGTTTGGACTATTCAGCTAACCCTCC
TCTTCAGGATATTTTTCCCAAGGATGTTCATGGCGAAAAGTGGCATTTCA
GGCACGTTTATAGGGGCACGCCGAAGAGGCATTTGTTGACAACTGGATGG
AGTCCTTTTGTCAGCGACAAGAAACTTGCGTCTGGGGATTCGATTGTGTT
TTTGAGATCTGAAAACGGCGATCTTCATGTTGGAATTCGGAGGGCTAAAA
GGCGAAATAATGTTGGAGTCGATCCTTTGTCAGGGTGGAAATCTGGTAGT
GGAATTGGAATTTGTGCTGCACCACCTTACGGAGGATTTCCATCGTTTTC
GGGAGAGGAAGATAATAAACTTCGAAGAAACGGTAAAGGTAATGGATTGC
TAATAAGTGATGGAATGATGGGTAGGGGGAAGGTGAAAGCTCTAGAAGTT
ATTGAAGCAGTAAGACTCGGTACTAATATGCAGCCGTTTGATGTGGTTTA
TTATCCTCGGTCGGGTACTCCTGAGTTTTTTGTGAAAACTTCTTTAATTG
GAATGGCACTTCAGATTAGGTGGTGTCCTGGAATGAGGTTCAAGATGGCC
ATTGAAACCGAGGACTCATCAAGGATAAGTTGGTTTATCGGAACTGTTGC
TTCTGTTCAGGCTGCTGATCCGTCATGGTCTGATTCTATGTGGAGACTTC
TCGAGGTTACATGGGATGAACCTGAGTTACTTAAAAATGTGAAAAGAGTG
AATCCGTGGCAAGTTGAAATAGTATCGAACATGCCTTCGATCCCTCTTTC
GCCTTTCATACCGCCAAGGAAGAAATTGAGATTGCCTCAACTCCCAGATT
TCCCAATTGATGGCCAATTTCCAATGCCAACTTTTCCAAACAACCTTCTA
AGTCCTAATATTCCAATTTTTTATTTACCCGAAACTAGTCCTGCCGGCAT
GCAGGGAGCCAGGCATGGTCATTTCGGTGTTACCTTACCAGATTTTCATA
ATCTTCCATTAGGTCTCTTTCAGCCTAGTTTCCAACAACCGTTTAATAAT
ATTGCGACAATGCCGATGACTGTCCCTAATAACCCGGCATTGCAAAAGCC
GAACACCAGTGAGAACGTTTCATGCTCGCATTCGATATCAACTTCTGCAC
AATCTTCAGAGAAACCGGATCATGCAAAGCCGCACCAACTTGTGCTTTTT
GGCCAAACAATACAAGTTGACGCTGGAAATGAAAATTCCGAGAAGAAAAT
GTCTAATCATTTGTCTGATCTTCATCTACAAGGCCTGTCGTCAAGATCAT
CTGATGCGAGGTTCGAGTGGAATGCTGAGAACCAACACGAAGAAACATTG
GCAGGAGAAACATTAGAGATGAAACATTCAGACTTCATCAGAAAAGCTAG
GAGGTTGACAATTTTAATGGATTCCACTAGCGGCGCGACAACGGAGGATC
AGCAAGAAAAAAAAGAAAACCACCAGTTCAATTGTAGAGCTGGATGA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR003340Transcriptional factor B3
IPR015300DNA-binding pseudobarrel domain
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0003677DNA binding