Overview
NameMedtr0041s0100.1
Unique NameMedtr0041s0100.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length663
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0008150 biological_process
biological_process GO:0009987 cellular process
biological_process GO:0070887 cellular response to chemical stimulus
biological_process GO:0035690 cellular response to drug
biological_process GO:0051716 cellular response to stimulus
biological_process GO:0042221 response to chemical
biological_process GO:0042493 response to drug
biological_process GO:0009719 response to endogenous stimulus
biological_process GO:1901698 response to nitrogen compound
biological_process GO:0014070 response to organic cyclic compound
biological_process GO:0010033 response to organic substance
biological_process GO:0010243 response to organonitrogen compound
biological_process GO:0014074 response to purine-containing compound
biological_process GO:0050896 response to stimulus
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005737 cytoplasm
cellular_component GO:0044444 cytoplasmic part
cellular_component GO:0005622 intracellular
cellular_component GO:0043231 intracellular membrane-bounded organelle
cellular_component GO:0043229 intracellular organelle
cellular_component GO:0044424 intracellular part
cellular_component GO:0043227 membrane-bounded organelle
cellular_component GO:0043226 organelle
cellular_component GO:0009536 plastid
molecular_function GO:0005488 binding
molecular_function GO:0042802 identical protein binding
molecular_function GO:0003674 molecular_function
molecular_function GO:0005515 protein binding
molecular_function GO:0046983 protein dimerization activity
molecular_function GO:0042803 protein homodimerization activity
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF03641.976677-7706958-1881-133162.43e-52162.73.2e-48

Homology
BLAST of Medtr0041s0100.1 vs. NCBI nr
Match: gi|502111171|ref|XP_004493974.1| (PREDICTED: cytokinin riboside 5'-monophosphate phosphoribohydrolase LOG3-like isoform X1 [Cicer arietinum])
BLAST of Medtr0041s0100.1 vs. NCBI nr
Match: gi|359806146|ref|NP_001241195.1| (uncharacterized protein LOC100787375 [Glycine max] >gi|255636635|gb|ACU18655.1| unknown [Glycine max])
BLAST of Medtr0041s0100.1 vs. NCBI nr
Match: gi|356572448|ref|XP_003554380.1| (PREDICTED: cytokinin riboside 5'-monophosphate phosphoribohydrolase LOG3-like [Glycine max])
BLAST of Medtr0041s0100.1 vs. NCBI nr
Match: gi|358248802|ref|NP_001240198.1| (uncharacterized protein LOC100791145 [Glycine max] >gi|255635431|gb|ACU18068.1| unknown [Glycine max])
BLAST of Medtr0041s0100.1 vs. NCBI nr
Match: gi|502121964|ref|XP_004497512.1| (PREDICTED: cytokinin riboside 5'-monophosphate phosphoribohydrolase LOG3-like [Cicer arietinum])
BLAST of Medtr0041s0100.1 vs. NCBI nr
Match: gi|388504184|gb|AFK40158.1| (unknown [Lotus japonicus])
BLAST of Medtr0041s0100.1 vs. NCBI nr
Match: gi|224069464|ref|XP_002326355.1| (predicted protein [Populus trichocarpa])
BLAST of Medtr0041s0100.1 vs. NCBI nr
Match: gi|590630668|ref|XP_007027342.1| (Lysine decarboxylase family protein isoform 2 [Theobroma cacao] >gi|508715947|gb|EOY07844.1| Lysine decarboxylase family protein isoform 2 [Theobroma cacao])
BLAST of Medtr0041s0100.1 vs. NCBI nr
Match: gi|359481376|ref|XP_002276279.2| (PREDICTED: cytokinin riboside 5'-monophosphate phosphoribohydrolase LOG3-like [Vitis vinifera] >gi|297741608|emb|CBI32740.3| unnamed protein product [Vitis vinifera])
BLAST of Medtr0041s0100.1 vs. NCBI nr
Match: gi|595833945|ref|XP_007206768.1| (hypothetical protein PRUPE_ppa025305mg [Prunus persica] >gi|645277803|ref|XP_008243947.1| PREDICTED: cytokinin riboside 5'-monophosphate phosphoribohydrolase LOG3 [Prunus mume] >gi|462402410|gb|EMJ07967.1| hypothetical protein PRUPE_ppa025305mg [Prunus persica])
The following BLAST results are available for this feature:
BLAST of Medtr0041s0100.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502111171|ref|XP_004493974.1|5.752980e-15495.45PREDICTED: cytokinin riboside 5'-monophosphate pho... [more]
gi|359806146|ref|NP_001241195.1|1.012500e-15194.55uncharacterized protein LOC100787375 [Glycine max]... [more]
gi|356572448|ref|XP_003554380.1|5.576220e-15194.09PREDICTED: cytokinin riboside 5'-monophosphate pho... [more]
gi|358248802|ref|NP_001240198.1|8.666040e-14892.59uncharacterized protein LOC100791145 [Glycine max]... [more]
gi|502121964|ref|XP_004497512.1|2.130040e-14794.76PREDICTED: cytokinin riboside 5'-monophosphate pho... [more]
gi|388504184|gb|AFK40158.1|4.290400e-14392.89unknown [Lotus japonicus][more]
gi|224069464|ref|XP_002326355.1|1.442120e-13891.47predicted protein [Populus trichocarpa][more]
gi|590630668|ref|XP_007027342.1|4.188740e-13889.72Lysine decarboxylase family protein isoform 2 [The... [more]
gi|359481376|ref|XP_002276279.2|3.567620e-13788.84PREDICTED: cytokinin riboside 5'-monophosphate pho... [more]
gi|595833945|ref|XP_007206768.1|4.740040e-13788.79hypothetical protein PRUPE_ppa025305mg [Prunus per... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR005269Cytokinin riboside 5'-monophosphate phosphoribohydrolase LOGTIGRFAMsTIGR00730TIGR00730: conserved hypothetical protein Tcoord: 14..191
score: 1.1
NoneNo IPR availableGENE3D3.40.50.450no descriptioncoord: 10..190
score: 2.8
NoneNo IPR availableSUPERFAMILY102405MoCo carrier protein-likecoord: 9..192
score: 3.8

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0041s0100.1 ID=Medtr0041s0100.1|Name=Medtr0041s0100.1|organism=Medicago truncatula|type=mRNA|length=663bp
ATGGACTCACGCAATGGTGAGATAAAGCTTTCAAAGTTCAAAAGAATTTG
TGTTTTCTGTGGAAGTAGTCCTGGTAAAAAAACTACCTACCAAGATGCTG
CCATGAACCTTGGCAATGAATTGGTTTCAAGGAACATTGATCTTGTGTAT
GGAGGAGGAAGCATTGGTCTCATGGGTTTAGTTTCTCAAGCTGTTCATGA
TGGTGGTCGCCATGTCATTGGAGTTATTCCCAAGACACTCATGCCTCGAG
AGCTAACTGGTGAAACAGTAGGAGAAGTTAAGGCTGTTGCTGATATGCAT
CAAAGGAAAGCTGAGATGGCCAAACATTCAGATGCTTTTATTGCCTTACC
AGGGGGATATGGAACTCTGGAGGAACTTCTTGAAGTCATAACATGGGCTC
AACTTGGAATTCATGACAAGCCGGTTGGATTAGTAAATGTTGATGGATAC
TTTAACTCCTTGTTGTCATTCATTGACAAAGCTGTGGAAGAAGGGTTTAT
TAGTCCAAATGCTCGTCACATAATTGTATCAGCACCAACTGCAAAAGAGT
TGGTCAAGAAATTGGAGGAGTATGTTCCATGTCATGAGGGTGTTGCTTCC
AAGTTGAGCTGGCAGATGGAACAGCAGCTAGCATACCCTCAAGATTATGA
CATCTCAAGGTAG
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR005269Cytokinin riboside 5'-monophosphate phosphoribohydrolase LOG
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0005515protein binding
GO:0003674molecular_function
GO:0005488binding
GO:0046983protein dimerization activity
GO:0042802identical protein binding
GO:0042803protein homodimerization activity
Vocabulary: Cellular Component
TermDefinition
GO:0005622intracellular
GO:0005575cellular_component
GO:0005623cell
GO:0005737cytoplasm
GO:0043231intracellular membrane-bounded organelle
GO:0009536plastid
GO:0043226organelle
GO:0043227membrane-bounded organelle
GO:0043229intracellular organelle
GO:0044424intracellular part
GO:0044444cytoplasmic part
GO:0044464cell part
Vocabulary: Biological Process
TermDefinition
GO:0008150biological_process
GO:0042493response to drug
GO:0009719response to endogenous stimulus
GO:0009987cellular process
GO:0010033response to organic substance
GO:0010243response to organonitrogen compound
GO:0014070response to organic cyclic compound
GO:0014074response to purine-containing compound
GO:0070887cellular response to chemical stimulus
GO:0035690cellular response to drug
GO:0042221response to chemical
GO:0050896response to stimulus
GO:0051716cellular response to stimulus
GO:1901698response to nitrogen compound