Overview
NameMedtr0041s0080.1
Unique NameMedtr0041s0080.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length582
Homology
BLAST of Medtr0041s0080.1 vs. NCBI nr
Match: gi|502111178|ref|XP_004493976.1| (PREDICTED: ethylene-insensitive protein 2-like [Cicer arietinum])
BLAST of Medtr0041s0080.1 vs. NCBI nr
Match: gi|297741613|emb|CBI32745.3| (unnamed protein product [Vitis vinifera])
BLAST of Medtr0041s0080.1 vs. NCBI nr
Match: gi|356503712|ref|XP_003520649.1| (PREDICTED: ethylene-insensitive protein 2-like [Glycine max])
BLAST of Medtr0041s0080.1 vs. NCBI nr
Match: gi|356548291|ref|XP_003542536.1| (PREDICTED: ethylene-insensitive protein 2-like [Glycine max])
BLAST of Medtr0041s0080.1 vs. NCBI nr
Match: gi|356536969|ref|XP_003537004.1| (PREDICTED: ethylene-insensitive protein 2-like [Glycine max])
BLAST of Medtr0041s0080.1 vs. NCBI nr
Match: gi|147783157|emb|CAN66374.1| (hypothetical protein VITISV_043425 [Vitis vinifera])
BLAST of Medtr0041s0080.1 vs. NCBI nr
Match: gi|225440009|ref|XP_002276399.1| (PREDICTED: ethylene-insensitive protein 2-like [Vitis vinifera])
BLAST of Medtr0041s0080.1 vs. NCBI nr
Match: gi|661902848|ref|NP_001284437.1| (ethylene-insensitive protein 2 [Cucumis melo] >gi|319960347|gb|ADV90799.1| ethylene insensitive 2 [Cucumis melo])
BLAST of Medtr0041s0080.1 vs. NCBI nr
Match: gi|224138710|ref|XP_002322882.1| (EIN2 -like protein, nramp transporter [Populus trichocarpa])
BLAST of Medtr0041s0080.1 vs. NCBI nr
Match: gi|449451008|ref|XP_004143254.1| (PREDICTED: ethylene-insensitive protein 2-like [Cucumis sativus])
The following BLAST results are available for this feature:
BLAST of Medtr0041s0080.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502111178|ref|XP_004493976.1|3.957550e-3469.00PREDICTED: ethylene-insensitive protein 2-like [Ci... [more]
gi|297741613|emb|CBI32745.3|1.545190e-3036.44unnamed protein product [Vitis vinifera][more]
gi|356503712|ref|XP_003520649.1|1.660790e-2353.77PREDICTED: ethylene-insensitive protein 2-like [Gl... [more]
gi|356548291|ref|XP_003542536.1|5.656590e-2344.60PREDICTED: ethylene-insensitive protein 2-like [Gl... [more]
gi|356536969|ref|XP_003537004.1|8.240800e-2251.00PREDICTED: ethylene-insensitive protein 2-like [Gl... [more]
gi|147783157|emb|CAN66374.1|1.362030e-1756.96hypothetical protein VITISV_043425 [Vitis vinifera... [more]
gi|225440009|ref|XP_002276399.1|2.761500e-1755.70PREDICTED: ethylene-insensitive protein 2-like [Vi... [more]
gi|661902848|ref|NP_001284437.1|5.250890e-1660.56ethylene-insensitive protein 2 [Cucumis melo] >gi|... [more]
gi|224138710|ref|XP_002322882.1|1.192030e-1544.44EIN2 -like protein, nramp transporter [Populus tri... [more]
gi|449451008|ref|XP_004143254.1|1.601190e-1559.15PREDICTED: ethylene-insensitive protein 2-like [Cu... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableSEGsegsegcoord: 133..149
score: NAcoord: 154..164
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0041s0080.1 ID=Medtr0041s0080.1|Name=Medtr0041s0080.1|organism=Medicago truncatula|type=mRNA|length=582bp
ATGATATTTAGCAATATTGATTGGGCAGGTGATTTGAGGTGGAATGTGGG
GAATGGCGTGTCTATTTCGTATTTAGTTCTTCTCATTGCTGGTTTTGTAT
CAATATGTTTGATGCTTCGGTCAGCTACCACACCTTTAAGATCTGCCATC
ATTCAATTAAATCATGTCTTAAACTGGGATATGATAGAGGTTGTGCCGAA
TCCGCTAGTTGATATCAAAGAATCATATGTAATTGAAACAATGGATCATG
AAGGTGCATCTTTCCAAACCGTCGAACCAAAAGCAGCTTTAGCAAGGGAC
GATGACGATGTAGACTCATGGGAAATTGAAAAATCATCCAAATCAATCTT
GACAAATGCCCCATCATCAACATCAGAAGTACCTCTATCATTCACGAGTA
TCAGTGGGAAAAGTGATGATGGTGGTGACGGCTTTGGAAGTCTATCGAAA
ATAGAAGGCTTAAGACGTGCTGCAAGACGTCAGCTAGCTGCTACTCTTTA
TGATTTTGAGGACATCAATATGTTGACCTACTTTAGACATGGCTTCATAT
ACACAAATGTGTATGGGACGAATTCCACATAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated