Overview
NameMedtr0041s0060.1
Unique NameMedtr0041s0060.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length171
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0008150 biological_process
biological_process GO:0044260 cellular macromolecule metabolic process
biological_process GO:0044237 cellular metabolic process
biological_process GO:0009987 cellular process
biological_process GO:0044267 cellular protein metabolic process
biological_process GO:0006464 cellular protein modification process
biological_process GO:0043170 macromolecule metabolic process
biological_process GO:0043412 macromolecule modification
biological_process GO:0008152 metabolic process
biological_process GO:0071704 organic substance metabolic process
biological_process GO:0044238 primary metabolic process
biological_process GO:0019538 protein metabolic process
biological_process GO:0036211 protein modification process
biological_process GO:0006508 proteolysis
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005737 cytoplasm
cellular_component GO:0005622 intracellular
cellular_component GO:0044424 intracellular part
molecular_function GO:0016881 acid-amino acid ligase activity
molecular_function GO:0005488 binding
molecular_function GO:0003824 catalytic activity
molecular_function GO:0016874 ligase activity
molecular_function GO:0016879 ligase activity, forming carbon-nitrogen bonds
molecular_function GO:0003674 molecular_function
molecular_function GO:0005515 protein binding
molecular_function GO:0019787 small conjugating protein ligase activity
molecular_function GO:0004842 ubiquitin-protein transferase activity
Homology
BLAST of Medtr0041s0060.1 vs. NCBI nr
Match: gi|502101960|ref|XP_004491924.1| (PREDICTED: uncharacterized protein LOC101493919 [Cicer arietinum])
BLAST of Medtr0041s0060.1 vs. NCBI nr
Match: gi|502094280|ref|XP_004490180.1| (PREDICTED: F-box/LRR-repeat protein 3-like [Cicer arietinum])
BLAST of Medtr0041s0060.1 vs. NCBI nr
Match: gi|356522300|ref|XP_003529785.1| (PREDICTED: F-box/LRR-repeat protein 2-like [Glycine max])
BLAST of Medtr0041s0060.1 vs. NCBI nr
Match: gi|502174460|ref|XP_004515522.1| (PREDICTED: F-box/LRR-repeat protein 3-like isoform X1 [Cicer arietinum] >gi|502174464|ref|XP_004515523.1| PREDICTED: F-box/LRR-repeat protein 3-like isoform X2 [Cicer arietinum] >gi|502174468|ref|XP_004515524.1| PREDICTED: F-box/LRR-repeat protein 3-like isoform X3 [Cicer arietinum] >gi|502174471|ref|XP_004515525.1| PREDICTED: F-box/LRR-repeat protein 3-like isoform X4 [Cicer arietinum])
BLAST of Medtr0041s0060.1 vs. NCBI nr
Match: gi|356529000|ref|XP_003533085.1| (PREDICTED: F-box/LRR-repeat protein 2-like [Glycine max])
BLAST of Medtr0041s0060.1 vs. NCBI nr
Match: gi|18412879|ref|NP_565242.1| (RNI-like superfamily protein [Arabidopsis thaliana] >gi|6730724|gb|AAF27114.1|AC018849_2 hypothetical protein; 8015-9751 [Arabidopsis thaliana] >gi|21592320|gb|AAM64271.1| unknown [Arabidopsis thaliana] >gi|110739194|dbj|BAF01513.1| hypothetical protein [Arabidopsis thaliana] >gi|195546962|gb|ACG49251.1| At1g80630 [Arabidopsis thaliana] >gi|332198308|gb|AEE36429.1| RNI-like superfamily protein [Arabidopsis thaliana])
BLAST of Medtr0041s0060.1 vs. NCBI nr
Match: gi|255572789|ref|XP_002527327.1| (F-box/LRR-repeat protein, putative [Ricinus communis] >gi|223533327|gb|EEF35079.1| F-box/LRR-repeat protein, putative [Ricinus communis])
BLAST of Medtr0041s0060.1 vs. NCBI nr
Match: gi|297839871|ref|XP_002887817.1| (leucine-rich repeat family protein [Arabidopsis lyrata subsp. lyrata] >gi|297333658|gb|EFH64076.1| leucine-rich repeat family protein [Arabidopsis lyrata subsp. lyrata])
BLAST of Medtr0041s0060.1 vs. NCBI nr
Match: gi|595935932|ref|XP_007215517.1| (hypothetical protein PRUPE_ppa003687mg [Prunus persica] >gi|462411667|gb|EMJ16716.1| hypothetical protein PRUPE_ppa003687mg [Prunus persica])
BLAST of Medtr0041s0060.1 vs. NCBI nr
Match: gi|502174475|ref|XP_004515526.1| (PREDICTED: F-box/LRR-repeat protein 2-like [Cicer arietinum])
The following BLAST results are available for this feature:
BLAST of Medtr0041s0060.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502101960|ref|XP_004491924.1|1.701660e-1671.43PREDICTED: uncharacterized protein LOC101493919 [C... [more]
gi|502094280|ref|XP_004490180.1|2.938170e-1669.64PREDICTED: F-box/LRR-repeat protein 3-like [Cicer ... [more]
gi|356522300|ref|XP_003529785.1|3.943450e-1262.50PREDICTED: F-box/LRR-repeat protein 2-like [Glycin... [more]
gi|502174460|ref|XP_004515522.1|4.398610e-1158.93PREDICTED: F-box/LRR-repeat protein 3-like isoform... [more]
gi|356529000|ref|XP_003533085.1|8.493550e-950.00PREDICTED: F-box/LRR-repeat protein 2-like [Glycin... [more]
gi|18412879|ref|NP_565242.1|1.566980e-851.79RNI-like superfamily protein [Arabidopsis thaliana... [more]
gi|255572789|ref|XP_002527327.1|1.597460e-853.57F-box/LRR-repeat protein, putative [Ricinus commun... [more]
gi|297839871|ref|XP_002887817.1|1.791000e-851.79leucine-rich repeat family protein [Arabidopsis ly... [more]
gi|595935932|ref|XP_007215517.1|1.723420e-748.21hypothetical protein PRUPE_ppa003687mg [Prunus per... [more]
gi|502174475|ref|XP_004515526.1|1.834910e-748.21PREDICTED: F-box/LRR-repeat protein 2-like [Cicer ... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableGENE3D3.80.10.10no descriptioncoord: 2..56
score: 4.1

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0041s0060.1 ID=Medtr0041s0060.1|Name=Medtr0041s0060.1|organism=Medicago truncatula|type=mRNA|length=171bp
ATGGAAGTGTTGAACTTGACATTTACAAAGGTTAATGATGAAACACTTTA
TGTGATCTCAAAGAGTTGTAGTGGGCTTTTGCACCTGATACTGGAAAAAT
GTTCTCGTGTCACAATGAAGGGAGTGAAACATGTGGTAAACAACTGCACG
CAACTGAGAGAGATTAATTGA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0005515protein binding
GO:0003674molecular_function
GO:0003824catalytic activity
GO:0004842ubiquitin-protein transferase activity
GO:0005488binding
GO:0016874ligase activity
GO:0016879ligase activity, forming carbon-nitrogen bonds
GO:0016881acid-amino acid ligase activity
GO:0019787small conjugating protein ligase activity
Vocabulary: Cellular Component
TermDefinition
GO:0005622intracellular
GO:0005575cellular_component
GO:0005623cell
GO:0005737cytoplasm
GO:0044424intracellular part
GO:0044464cell part
Vocabulary: Biological Process
TermDefinition
GO:0008152metabolic process
GO:0006464cellular protein modification process
GO:0006508proteolysis
GO:0008150biological_process
GO:0009987cellular process
GO:0019538protein metabolic process
GO:0036211protein modification process
GO:0043170macromolecule metabolic process
GO:0043412macromolecule modification
GO:0044237cellular metabolic process
GO:0044238primary metabolic process
GO:0044260cellular macromolecule metabolic process
GO:0044267cellular protein metabolic process
GO:0071704organic substance metabolic process