Overview
NameMedtr0041s0030.1
Unique NameMedtr0041s0030.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length3930
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0065007 biological regulation
biological_process GO:0008150 biological_process
biological_process GO:0055080 cation homeostasis
biological_process GO:0006812 cation transport
biological_process GO:0030003 cellular cation homeostasis
biological_process GO:0055082 cellular chemical homeostasis
biological_process GO:0019725 cellular homeostasis
biological_process GO:0006873 cellular ion homeostasis
biological_process GO:0006879 cellular iron ion homeostasis
biological_process GO:0006875 cellular metal ion homeostasis
biological_process GO:0009987 cellular process
biological_process GO:0046916 cellular transition metal ion homeostasis
biological_process GO:0048878 chemical homeostasis
biological_process GO:0051234 establishment of localization
biological_process GO:0042592 homeostatic process
biological_process GO:0050801 ion homeostasis
biological_process GO:0006811 ion transport
biological_process GO:0055072 iron ion homeostasis
biological_process GO:0006826 iron ion transport
biological_process GO:0051179 localization
biological_process GO:0055065 metal ion homeostasis
biological_process GO:0030001 metal ion transport
biological_process GO:0065008 regulation of biological quality
biological_process GO:0044763 single-organism cellular process
biological_process GO:0044699 single-organism process
biological_process GO:0044765 single-organism transport
biological_process GO:0055076 transition metal ion homeostasis
biological_process GO:0000041 transition metal ion transport
biological_process GO:0006810 transport
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0071944 cell periphery
cellular_component GO:0005575 cellular_component
cellular_component GO:0016020 membrane
cellular_component GO:0005886 plasma membrane
molecular_function GO:0008324 cation transmembrane transporter activity
molecular_function GO:0022890 inorganic cation transmembrane transporter activity
molecular_function GO:0015075 ion transmembrane transporter activity
molecular_function GO:0003674 molecular_function
molecular_function GO:0022891 substrate-specific transmembrane transporter activity
molecular_function GO:0022892 substrate-specific transporter activity
molecular_function GO:0022857 transmembrane transporter activity
molecular_function GO:0005215 transporter activity
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF01566.1315049-1608352-3961-356259.91.8e-81259.92.4e-77

Homology
BLAST of Medtr0041s0030.1 vs. NCBI nr
Match: gi|502111178|ref|XP_004493976.1| (PREDICTED: ethylene-insensitive protein 2-like [Cicer arietinum])
BLAST of Medtr0041s0030.1 vs. NCBI nr
Match: gi|356503712|ref|XP_003520649.1| (PREDICTED: ethylene-insensitive protein 2-like [Glycine max])
BLAST of Medtr0041s0030.1 vs. NCBI nr
Match: gi|356548291|ref|XP_003542536.1| (PREDICTED: ethylene-insensitive protein 2-like [Glycine max])
BLAST of Medtr0041s0030.1 vs. NCBI nr
Match: gi|356536969|ref|XP_003537004.1| (PREDICTED: ethylene-insensitive protein 2-like [Glycine max])
BLAST of Medtr0041s0030.1 vs. NCBI nr
Match: gi|590630693|ref|XP_007027349.1| (EIN2-like protein, nramp transporter isoform 1 [Theobroma cacao] >gi|590630697|ref|XP_007027350.1| EIN2-like protein, nramp transporter isoform 1 [Theobroma cacao] >gi|508715954|gb|EOY07851.1| EIN2-like protein, nramp transporter isoform 1 [Theobroma cacao] >gi|508715955|gb|EOY07852.1| EIN2-like protein, nramp transporter isoform 1 [Theobroma cacao])
BLAST of Medtr0041s0030.1 vs. NCBI nr
Match: gi|224068729|ref|XP_002326185.1| (EIN2 -like protein, nramp transporter [Populus trichocarpa])
BLAST of Medtr0041s0030.1 vs. NCBI nr
Match: gi|225440009|ref|XP_002276399.1| (PREDICTED: ethylene-insensitive protein 2-like [Vitis vinifera])
BLAST of Medtr0041s0030.1 vs. NCBI nr
Match: gi|595841041|ref|XP_007208136.1| (hypothetical protein PRUPE_ppa000305mg [Prunus persica] >gi|462403778|gb|EMJ09335.1| hypothetical protein PRUPE_ppa000305mg [Prunus persica])
BLAST of Medtr0041s0030.1 vs. NCBI nr
Match: gi|147783157|emb|CAN66374.1| (hypothetical protein VITISV_043425 [Vitis vinifera])
BLAST of Medtr0041s0030.1 vs. NCBI nr
Match: gi|266706186|gb|ACY78397.1| (ethylene insensitive 2 [Prunus persica])
The following BLAST results are available for this feature:
BLAST of Medtr0041s0030.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502111178|ref|XP_004493976.1|0.000000e+085.64PREDICTED: ethylene-insensitive protein 2-like [Ci... [more]
gi|356503712|ref|XP_003520649.1|0.000000e+073.75PREDICTED: ethylene-insensitive protein 2-like [Gl... [more]
gi|356548291|ref|XP_003542536.1|0.000000e+070.17PREDICTED: ethylene-insensitive protein 2-like [Gl... [more]
gi|356536969|ref|XP_003537004.1|0.000000e+068.56PREDICTED: ethylene-insensitive protein 2-like [Gl... [more]
gi|590630693|ref|XP_007027349.1|0.000000e+059.47EIN2-like protein, nramp transporter isoform 1 [Th... [more]
gi|224068729|ref|XP_002326185.1|0.000000e+058.77EIN2 -like protein, nramp transporter [Populus tri... [more]
gi|225440009|ref|XP_002276399.1|0.000000e+058.20PREDICTED: ethylene-insensitive protein 2-like [Vi... [more]
gi|595841041|ref|XP_007208136.1|0.000000e+058.69hypothetical protein PRUPE_ppa000305mg [Prunus per... [more]
gi|147783157|emb|CAN66374.1|0.000000e+057.15hypothetical protein VITISV_043425 [Vitis vinifera... [more]
gi|266706186|gb|ACY78397.1|0.000000e+058.46ethylene insensitive 2 [Prunus persica][more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR001046Natural resistance-associated macrophage proteinPRINTSPR00447NATRESASSCMPcoord: 111..137
score: 2.9e-19coord: 212..235
score: 2.9e-19coord: 306..325
score: 2.9e-19coord: 334..351
score: 2.9e-19coord: 366..385
score: 2.9
IPR017187Ethylene-insensitive 2PIRPIRSF037378Ethylene signal transduction EIN2coord: 15..
NoneNo IPR availableSEGsegsegcoord: 68..79
score: NAcoord: 577..590
score: NAcoord: 605..626
score: NAcoord: 666..677
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0041s0030.1 ID=Medtr0041s0030.1|Name=Medtr0041s0030.1|organism=Medicago truncatula|type=mRNA|length=3930bp
ATGGAAACAGAGGCATTGAGTTCTGAACAGACGAAGAGTAAAATGGAGGC
AGAGACATTGAGTACTAATCCCCCTCCTGGTTTTCTTATTCGCGCACTTC
CGGCTGTTATACCCGCGCTTTTGATTTCGATAGGATATGTTGACCCTGGA
AAGTGGGTGGCAAGTATAGAAGGTGGTGCGAGGTTTGGTTTTGATCTGGT
GGCTTTTGCGCTAATTTTCAATTTTGCCGCTATCTTCTGTCAGTACTTAT
CCGCAAGGGTTGGTGTAATCACTGGACGAGATCTTGCTCAGATTTGCAGT
GATGAATATGATACATGGACATGCCTTCTCCTTGGAATTCAAGCAGAACT
GTCCGTGATTATGCTAGATCTTAACATGATCTTGGGCATGGCACAAGGAT
TAAATCTTATTTTTGGGTGGGACTTGTTCACCTGTGTCTTTTTAACTGCC
ACTGGTGCTGTTTTTCATATTCTTCTTGCTATCCTCTTGGACATTGAGAA
GACAAAATTCCTAGGACAGTTTGTGGCAGGCTTTGTATTACTTTCTTTTA
TACTTGGAGTATTCATCCAATCCGAAGTTCCAGTTTCCATGAATGGAATA
CTAATAAATTTAAGCGGGGAGAGTACATTTATGCTGATGAGTCTTCTCGG
AGCAACTCTTGTGCCTCACAACTTTTACCTTCATTCTTCTATTGTACAGT
GGCATCAGGGACCGGCAAACATTTCTAAAGATGCACTGTGTCATAACCAT
TTTTTGGCCCTCTTATGTGTCTTCAGTGGCCTTTATTTGGTAAATTATAT
TCTGATGACCACCTTAGCAAATGAGTTCTACAGTACAGGTCCTGTTTTGC
TTATGGAACAGGTGTTACACAGCCCAATAGCCCTGATTGGCTTTGTACTC
ATTCTGTTTCTTGCCAATCAAACTGCAGCATTAACTTGGAGTTTAGGCGG
AGAAGTTGTAGTTAATGGTTTCTTAAAACTAGACATACCAGGTTGGCTTC
ATTATGCGACAATTAGAGTGATTGCTGTGCTGCCCGCCCTTTATTGTGTC
TGGAGTTCAGGAGCTGAAGGGATCTATCAACTACTAATATTCACTCAGGT
TTTAGTAGCTTTGCAGCTTCCGTCGTCTGTGATTCCTCTTTTTCGAGTTG
CCTTGTCTAGATCAATAATGGGTGCACACAAGGTCTCCCAGTCAATGGAG
CTTTTGGCGTTGACCATATTCCTTGGGGTGCTTGGCATGAATATCATGTT
TTTGGGAGAGATGATATTTGGCAGTAGTGATTGGGCGTGTGATTTGAGGT
GGAATTTGGGGAATGGCGTGTCTGTCTTGTTTTCAGTTCTCCTCATTGCT
GGTTTTTTATCAATATGTTTGATGCTTCGGTTAGCTACCACACCTTTAAG
ATCTGCCAGCATTCAATTAAATGCTCAGGTCTTAAACTGGGATATGCCAG
AGGCTGTACTAAATCCGCCGGTTGATGGTGAAGAATCACATGTAACTGAA
ACAGTGGGTCATGAAGATGCGTCTTTCCAAGCTGACGAACCAAAACCAGC
TTTGGCAAGGTCATTAGAGTACCCTGAAGTATCACTTGCTAGTTTTCGTC
CTGATCTACATCTACCTGAAACTGTAATGGAACCTGATCCCCAGGTGAAT
GCTTTAAAGGAAAATCATTCTGTTGCACCATCAGTTTCCACATCTGATTC
AGGGACAGTATCAAAAACTGTAGCTAATGATACTTCTAGTTCTGATTCTA
AACTTAAAGACACGAAAACTATCATTGAAGCAAATGCCCCAATTGAGAAG
ACCGTGGAAATTGAAGATGATTCTAATGTTGAAAGGGATGATGACGATGT
AGACTCATGGGAAACTGAAGAATCATCCAGAGCAGTCTTGGCAAATGCCC
CGTCATCAACATCAGAAGGTCCTCCATCATTCAGGAGTATTAGTGGGAAA
AGTGATGACGGTGGTTGTAGCTTTGGAAGTCTATCGAGAATAGAAGGCTT
AGGACGTGCTGCAAGACGTCAGCTAGCTGCTACTCTTGATGAATTTTGGG
GACAGCTTTATGATTTCCATGGTCAAGCAACCCAGGCAGCGAAGGCCAAG
AAAATTGATGTTTTGCTGGGGATGGGAGTAGATTCAAAACCCACCGCTTC
CTTGCAGAAAATGGATGCATGTGGAAAGGACTATTCTGAATACTTGGTAT
CTGTAGGGGGTAGAGCTTCCGACAATTTAATCAACGCTGGCCCGTATGAC
TATTCCAATCAGCCTAGGATGCAAAGTAATTCAGAGTCTGCATATGGTCT
TCAAAGGAGTTCTTCCTCAGTGCGGGCAAGTCCCATTCAGTTATTGGATG
CATATGTACAAAGTTCCAACCGCAATCTCAATGATTCTGGTGAGAGGCGC
TATTCCAGTGTTCGCAATCTTCATTCATCTGAGGCCTGGGATTATCAACC
AGCTACAATTCATGGTTATCAGACCGCATCCTATCTTAGCCGGGGTGTGA
AAGATAGAAGTTCTGAAAACATAAATGGTTCAATGCCATTGACATCACTG
AAGTCCCCTTCCACAGGTAATCCAAACTATAGGGATTCCCTTGCATTCGT
TTTGGGAAAAAAGTTGCATAATGGTTCAGGTGTAGGCCATCCCCCTGGGT
TTGAAAATGTAGCTGTCTCTAGAAATCGCCAACTACAAACTGAGAGGTCC
AATTATGATTCTAGCTCCCCTGGAGCTGCAGCTAATACAGTCAGTTCAGT
TAACACTAAGAAATACCACAGCTTGCCGGACATTTCAGGATACTCCATTC
CCCACAGAGCTGGCTATGTGTCTGATAAGAATGCACCGTGGGATGGTTCT
GTTGGATATGGTTCTTTTGCTGGCAGGATGGGTTATGAACCATCTATGTA
TTCAAATTCTGGATCAAGAGCTGGAGGAGCTCATTTGGCCTTTGATGAAG
TCTCTCCATACAGAGAGGCACTCTCTTCGCAGTTTAGTTCTGGTTTTGAC
ACTGGATCCCTCTGGTCTAGACAGCCTTTTGAGCAGTTTGGTGTTGCTGG
TAAAATTCATAATGTTGCAATGGAAGGTGCGGGAAGCAGGCCTAATGCAA
TTGTTCAAGAAATTACATTTGAGGATATAGAGGGGAAACTTCTTCAGTCT
GTTAGACTTACCATTATGAAGCTCTTAAAACTAGAGGGATCTGATTGGTT
GTTTAAACAGAATGATGGAATTGATGAGGATCTGATTGATCGTGTAGCAG
CAAGGGATAAGTTTGTTTATGAAATTGAAGCTAGGGAAACGAATCAGGGT
ATTCATATGGGTGACACTCGTTATTTTCCTTCTGATAGGAAATCTGTTTC
TTCGATGAAAGTCAACGAGGCAAATGCCTCTAGTCTTTCGGTTTCCTCAG
TTCCCAACTGCGGGGAGGGATGTGTATGGAGAGCAGATTTAATAATAAGC
TTTGGGGTGTGGTGTATCCACCGTATTCTTGACCTGTCACTTTTGGAAAG
CCGGCCAGAGCTATGGGGAAAATACACCTACGTGCTCAATCGCCTCCAGG
GCATCATCGAACCAGCTTTTTCGAAGCCCCGTACTCCTTCGGCCCCTTGT
TTTTGCATTCAAGTTCCAACCACGCACCAGCAAAAGTCAAGCCCCCCTCT
TTCTAACGGGATGCTACCCCCAACGGTAAAACCAGGCCGGGGAAAATACA
CTACTGCATCATCGTTGCTTGAGCTGATTAAAGATGTGGAGATCGCTATC
TCTAGCAGGAAAGGACGTACAGGTACTGCAGCTGGTGAGGTGGCTTTCCC
AAAGGGGAAGGAAAATTTGGCATCCGTTCTTAAACGGTACAAGCGAAGGT
TATCATCCAACAAGCTTGTTGGCAATCAGGAGGGGACTAGTTCTCGCAAG
ATCCCGTCATCAGGACCATACAACCAATAG
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR001046Natural resistance-associated macrophage protein
IPR017187Ethylene-insensitive 2
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0005215transporter activity
GO:0003674molecular_function
GO:0022857transmembrane transporter activity
GO:0008324cation transmembrane transporter activity
GO:0015075ion transmembrane transporter activity
GO:0022891substrate-specific transmembrane transporter activity
GO:0022890inorganic cation transmembrane transporter activity
GO:0022892substrate-specific transporter activity
Vocabulary: Biological Process
TermDefinition
GO:0006810transport
GO:0000041transition metal ion transport
GO:0006811ion transport
GO:0006812cation transport
GO:0030001metal ion transport
GO:0006826iron ion transport
GO:0006873cellular ion homeostasis
GO:0006875cellular metal ion homeostasis
GO:0006879cellular iron ion homeostasis
GO:0008150biological_process
GO:0009987cellular process
GO:0019725cellular homeostasis
GO:0030003cellular cation homeostasis
GO:0042592homeostatic process
GO:0044699single-organism process
GO:0044763single-organism cellular process
GO:0044765single-organism transport
GO:0050801ion homeostasis
GO:0046916cellular transition metal ion homeostasis
GO:0048878chemical homeostasis
GO:0051179localization
GO:0051234establishment of localization
GO:0055065metal ion homeostasis
GO:0055072iron ion homeostasis
GO:0055076transition metal ion homeostasis
GO:0055080cation homeostasis
GO:0055082cellular chemical homeostasis
GO:0065007biological regulation
GO:0065008regulation of biological quality
Vocabulary: Cellular Component
TermDefinition
GO:0016020membrane
GO:0005886plasma membrane
GO:0005575cellular_component
GO:0005623cell
GO:0044464cell part
GO:0071944cell periphery