Overview
NameMedtr0040s0150.1
Unique NameMedtr0040s0150.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length243
Homology
BLAST of Medtr0040s0150.1 vs. NCBI nr
Match: gi|502168772|ref|XP_004514463.1| (PREDICTED: lanC-like protein 2-like [Cicer arietinum])
BLAST of Medtr0040s0150.1 vs. NCBI nr
Match: gi|356542916|ref|XP_003539910.1| (PREDICTED: lanC-like protein GCL2-like [Glycine max])
The following BLAST results are available for this feature:
BLAST of Medtr0040s0150.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 2
Match NameE-valueIdentityDescription
gi|502168772|ref|XP_004514463.1|2.082610e-1581.82PREDICTED: lanC-like protein 2-like [Cicer arietin... [more]
gi|356542916|ref|XP_003539910.1|2.613960e-1473.91PREDICTED: lanC-like protein GCL2-like [Glycine ma... [more]
back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
BlastP Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0040s0150.1 ID=Medtr0040s0150.1|Name=Medtr0040s0150.1|organism=Medicago truncatula|type=mRNA|length=243bp
ATGTTGTTAGAAGACTCAAAATCAAAACAGCAACAATACTACGATCCTCA
CTCTCACCCGAAACCATGTCAAATCCCATGCCCGAATTCATACCCGAATC
CCTTTCCCAATCCCATGCCAGAATTCATACCCGAATCAACACCTTCAACC
CAACAGGAACTCCAAGAAGCAGTCACCGTCACAACGGGCGGTGACTCACT
CCTCAACCTCCTCGCCATGCCTCATGCTCCATTGTTGGATTAA
back to top