Overview
NameMedtr0040s0140.1
Unique NameMedtr0040s0140.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length771
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0009664 plant-type cell wall organization
cellular_component GO:0005576 extracellular region
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF01357.1657051-57281166-2422-8279.61.5e-2680.36e-23
PF03330.1356757-5701768-1542-7873.61.3e-2474.54.3e-21

Homology
BLAST of Medtr0040s0140.1 vs. NCBI nr
Match: gi|502168738|ref|XP_004514456.1| (PREDICTED: expansin-A20-like [Cicer arietinum])
BLAST of Medtr0040s0140.1 vs. NCBI nr
Match: gi|356517524|ref|XP_003527437.1| (PREDICTED: expansin-A16-like [Glycine max])
BLAST of Medtr0040s0140.1 vs. NCBI nr
Match: gi|356542918|ref|XP_003539911.1| (PREDICTED: expansin-A16-like [Glycine max])
BLAST of Medtr0040s0140.1 vs. NCBI nr
Match: gi|255646620|gb|ACU23784.1| (unknown [Glycine max])
BLAST of Medtr0040s0140.1 vs. NCBI nr
Match: gi|595793689|ref|XP_007200593.1| (hypothetical protein PRUPE_ppa010203mg [Prunus persica] >gi|462395993|gb|EMJ01792.1| hypothetical protein PRUPE_ppa010203mg [Prunus persica])
BLAST of Medtr0040s0140.1 vs. NCBI nr
Match: gi|449454428|ref|XP_004144957.1| (PREDICTED: expansin-A16-like [Cucumis sativus] >gi|449473011|ref|XP_004153758.1| PREDICTED: expansin-A16-like [Cucumis sativus] >gi|449517152|ref|XP_004165610.1| PREDICTED: expansin-A16-like [Cucumis sativus])
BLAST of Medtr0040s0140.1 vs. NCBI nr
Match: gi|590688995|ref|XP_007043103.1| (Expansin A20, ALPHA 1.23,EXPA20 isoform 1 [Theobroma cacao] >gi|590688999|ref|XP_007043104.1| Expansin A20, ALPHA 1.23,EXPA20 isoform 1 [Theobroma cacao] >gi|508707038|gb|EOX98934.1| Expansin A20, ALPHA 1.23,EXPA20 isoform 1 [Theobroma cacao] >gi|508707039|gb|EOX98935.1| Expansin A20, ALPHA 1.23,EXPA20 isoform 1 [Theobroma cacao])
BLAST of Medtr0040s0140.1 vs. NCBI nr
Match: gi|470107504|ref|XP_004290085.1| (PREDICTED: expansin-A20-like [Fragaria vesca subsp. vesca])
BLAST of Medtr0040s0140.1 vs. NCBI nr
Match: gi|224131928|ref|XP_002328142.1| (hypothetical protein POPTRDRAFT_827261 [Populus trichocarpa])
BLAST of Medtr0040s0140.1 vs. NCBI nr
Match: gi|224104807|ref|XP_002313572.1| (alpha-expansin 20 precursor family protein [Populus trichocarpa] >gi|118483271|gb|ABK93538.1| unknown [Populus trichocarpa] >gi|222849980|gb|EEE87527.1| alpha-expansin 20 precursor family protein [Populus trichocarpa])
The following BLAST results are available for this feature:
BLAST of Medtr0040s0140.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502168738|ref|XP_004514456.1|9.267820e-17691.02PREDICTED: expansin-A20-like [Cicer arietinum][more]
gi|356517524|ref|XP_003527437.1|2.013680e-16786.45PREDICTED: expansin-A16-like [Glycine max][more]
gi|356542918|ref|XP_003539911.1|5.473440e-16686.45PREDICTED: expansin-A16-like [Glycine max][more]
gi|255646620|gb|ACU23784.1|1.114170e-16586.06unknown [Glycine max][more]
gi|595793689|ref|XP_007200593.1|6.472520e-14882.48hypothetical protein PRUPE_ppa010203mg [Prunus per... [more]
gi|449454428|ref|XP_004144957.1|5.317730e-14574.00PREDICTED: expansin-A16-like [Cucumis sativus] >gi... [more]
gi|590688995|ref|XP_007043103.1|1.688450e-14474.50Expansin A20, ALPHA 1.23,EXPA20 isoform 1 [Theobro... [more]
gi|470107504|ref|XP_004290085.1|4.435550e-14380.79PREDICTED: expansin-A20-like [Fragaria vesca subsp... [more]
gi|224131928|ref|XP_002328142.1|1.435790e-14274.50hypothetical protein POPTRDRAFT_827261 [Populus tr... [more]
gi|224104807|ref|XP_002313572.1|1.709960e-14274.10alpha-expansin 20 precursor family protein [Populu... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR002963ExpansinPRINTSPR01226EXPANSINcoord: 62..76
score: 2.2e-51coord: 89..100
score: 2.2e-51coord: 103..113
score: 2.2e-51coord: 122..139
score: 2.2e-51coord: 139..152
score: 2.2e-51coord: 163..175
score: 2.2e-51coord: 175..196
score: 2.2e-51coord: 210..231
score: 2.2e-51coord: 239..255
score: 2.2
IPR007112Expansin/pollen allergen, DPBB domainSMARTSM00837no descriptioncoord: 67..154
score: 7.4
IPR007112Expansin/pollen allergen, DPBB domainPROFILEPS50842EXPANSIN_EG45coord: 50..164
score: 27
IPR007117Pollen allergen/expansin, C-terminalGENE3D2.60.40.760no descriptioncoord: 163..254
score: 1.1
IPR007117Pollen allergen/expansin, C-terminalPROFILEPS50843EXPANSIN_CBDcoord: 174..253
score: 21
IPR007117Pollen allergen/expansin, C-terminalSUPERFAMILY49590PHL pollen allergencoord: 161..253
score: 2.2
IPR007118Expansin/Lol pIPRINTSPR01225EXPANSNFAMLYcoord: 31..46
score: 1.4e-34coord: 49..67
score: 1.4e-34coord: 71..89
score: 1.4e-34coord: 147..163
score: 1.4e-34coord: 201..215
score: 1.4e-34coord: 239..253
score: 1.4
IPR009009Barwin-related endoglucanaseSUPERFAMILY50685Barwin-like endoglucanasescoord: 16..164
score: 1.5
IPR014733Barwin-like endoglucanaseGENE3D2.40.40.10no descriptioncoord: 18..160
score: 5.3
NoneNo IPR availableSEGsegsegcoord: 9..20
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0040s0140.1 ID=Medtr0040s0140.1|Name=Medtr0040s0140.1|organism=Medicago truncatula|type=mRNA|length=771bp
ATGCTGTTATCTAAAATGGGTGTTCTTCTGTTCACATTTCTCTACTTGAT
TTTATTATATTCAATCAACATTGTTGCTTACAAGGATCAAGAATGGAAGA
AAGCCACTGCAACTTATGCCAAAGACACAGAAGGATCTCTAATTACAGAA
GGAGCTTGTGGTTATGGAGATCTTCACAAAGCTAGCTATGGAAAACATAG
TGTTGGATTAAGCACAATTTTGTTCAACAGAGGGAGTACATGTGGGGCTT
GCTATGAGATCAGATGTGTTGACCATATCTTGTGGTGTATGCTTGGAAGT
CCTTCTGTTATTGTTACTGCCACTGATTTCTGTCCTCCTAATTTTGGCCT
CTCAGTTGATTATGGTGGTTGGTGTAACTTTCCAAGAGAACATTTTGAGT
TGTCACAAGCTGCATTTGCTGAAATTGCTAAGGGGAAAGCTGATATTATT
CCCATTCAATATAGAAGAGTGAAGTGTGAAAGAAGTGGAGGGTTGAAATT
CACAATGAGTGGAAGTTCTCATTTCTATCAAGTCCTGATAACTAATGTGG
GGTTAGATGGTGAAGTTTTTGCTGTGAAAGTGAAGGGATCTAGAACAGGA
TGGATACCAATGGCAAGGAATTGGGGAATGAATTGGCATTGCAATGTCAA
CCTTCAACATCAGCCTTTGTCCTTTGAGGTAACCAGCAGCACTGGAAAAA
CACTCACATCTTACAATGTAGCACCTCCAAACTGGCAATTTGGACAAACA
TTTCAAGGAAAACAATTTTAG
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR002963Expansin
IPR007112Expansin/pollen allergen, DPBB domain
IPR007117Pollen allergen/expansin, C-terminal
IPR007118Expansin/Lol pI
IPR009009Barwin-related endoglucanase
IPR014733Barwin-like endoglucanase
noIPRunintegrated
Vocabulary: Biological Process
TermDefinition
GO:0009664plant-type cell wall organization
Vocabulary: Cellular Component
TermDefinition
GO:0005576extracellular region