Overview
NameMedtr0040s0110.1
Unique NameMedtr0040s0110.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length735
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
molecular_function GO:0005488 binding
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF08238.750695-50802125-1601-3927.91.7e-1039.64.8e-10

Homology
BLAST of Medtr0040s0110.1 vs. NCBI nr
Match: gi|502168730|ref|XP_004514454.1| (PREDICTED: uncharacterized protein LOC101507579 isoform X1 [Cicer arietinum] >gi|502168734|ref|XP_004514455.1| PREDICTED: uncharacterized protein LOC101507579 isoform X2 [Cicer arietinum])
BLAST of Medtr0040s0110.1 vs. NCBI nr
Match: gi|356568431|ref|XP_003552414.1| (PREDICTED: uncharacterized protein LOC100817827 isoform X1 [Glycine max] >gi|571548564|ref|XP_006602822.1| PREDICTED: uncharacterized protein LOC100817827 isoform X2 [Glycine max])
BLAST of Medtr0040s0110.1 vs. NCBI nr
Match: gi|356526737|ref|XP_003531973.1| (PREDICTED: uncharacterized protein LOC100791197 isoform X1 [Glycine max] >gi|571473361|ref|XP_006585903.1| PREDICTED: uncharacterized protein LOC100791197 isoform X2 [Glycine max])
BLAST of Medtr0040s0110.1 vs. NCBI nr
Match: gi|255647974|gb|ACU24444.1| (unknown [Glycine max])
BLAST of Medtr0040s0110.1 vs. NCBI nr
Match: gi|595806238|ref|XP_007202418.1| (hypothetical protein PRUPE_ppa009708mg [Prunus persica] >gi|462397949|gb|EMJ03617.1| hypothetical protein PRUPE_ppa009708mg [Prunus persica])
BLAST of Medtr0040s0110.1 vs. NCBI nr
Match: gi|255575074|ref|XP_002528442.1| (conserved hypothetical protein [Ricinus communis] >gi|223532118|gb|EEF33925.1| conserved hypothetical protein [Ricinus communis])
BLAST of Medtr0040s0110.1 vs. NCBI nr
Match: gi|470126572|ref|XP_004299257.1| (PREDICTED: uncharacterized protein LOC101299298 [Fragaria vesca subsp. vesca])
BLAST of Medtr0040s0110.1 vs. NCBI nr
Match: gi|449443093|ref|XP_004139315.1| (PREDICTED: uncharacterized protein LOC101222228 [Cucumis sativus] >gi|449493614|ref|XP_004159376.1| PREDICTED: uncharacterized LOC101222228 [Cucumis sativus])
BLAST of Medtr0040s0110.1 vs. NCBI nr
Match: gi|590578065|ref|XP_007013407.1| (Binding isoform 1 [Theobroma cacao] >gi|508783770|gb|EOY31026.1| Binding isoform 1 [Theobroma cacao])
BLAST of Medtr0040s0110.1 vs. NCBI nr
Match: gi|224054484|ref|XP_002298283.1| (predicted protein [Populus trichocarpa])
The following BLAST results are available for this feature:
BLAST of Medtr0040s0110.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502168730|ref|XP_004514454.1|2.407290e-15288.84PREDICTED: uncharacterized protein LOC101507579 is... [more]
gi|356568431|ref|XP_003552414.1|6.002510e-14078.49PREDICTED: uncharacterized protein LOC100817827 is... [more]
gi|356526737|ref|XP_003531973.1|8.882030e-13978.09PREDICTED: uncharacterized protein LOC100791197 is... [more]
gi|255647974|gb|ACU24444.1|7.150630e-13777.29unknown [Glycine max][more]
gi|595806238|ref|XP_007202418.1|1.036020e-13475.81hypothetical protein PRUPE_ppa009708mg [Prunus per... [more]
gi|255575074|ref|XP_002528442.1|2.586550e-13374.30conserved hypothetical protein [Ricinus communis] ... [more]
gi|470126572|ref|XP_004299257.1|1.277210e-13074.80PREDICTED: uncharacterized protein LOC101299298 [F... [more]
gi|449443093|ref|XP_004139315.1|3.367710e-13074.70PREDICTED: uncharacterized protein LOC101222228 [C... [more]
gi|590578065|ref|XP_007013407.1|7.638210e-13076.69Binding isoform 1 [Theobroma cacao] >gi|508783770|... [more]
gi|224054484|ref|XP_002298283.1|6.582610e-12972.11predicted protein [Populus trichocarpa][more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR006597Sel1-likeSMARTSM00671no descriptioncoord: 98..124
score: 2.8e+02coord: 125..160
score: 3.4
IPR011990Tetratricopeptide-like helicalGENE3D1.25.40.10no descriptioncoord: 82..229
score: 1
NoneNo IPR availableSUPERFAMILY81901HCP-likecoord: 44..174
score: 2.9

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0040s0110.1 ID=Medtr0040s0110.1|Name=Medtr0040s0110.1|organism=Medicago truncatula|type=mRNA|length=735bp
ATGGTGAGAGGATTGCATAGCCGGAACAAGAAAGCCATGGAGTTTATTGC
CAAAGGATGGAATGCTTTGAAGGAGGTTGATAGAGTTATTGATTATTGTG
AGCTCAATGATAGGCGTCTCATCCCTCTTCTTAACACAGCAAAGGAGAAT
TTTGAGCTTGCTTTGGAGGCTGACAACACCAATACTCATGCTAGGTATTG
GTTGTCCAGATTGCATATGAAATACCATGTTCCTGGAGCAAATAAGGCTG
TAGCGTCAGCATTATTAGTAGAAGCAGCAAATATGGGTGATCCTAATGCA
CAACAGAATGAGGATATCCATTCAGATCAACAAGCTTTTTATTATTTGGA
GAAAGCTGTGGATCAGTTGCATCCAGATGCTCTTTACCTTTTGGGTGCTG
TATATTTGACTGGCGACTGTGTTAAGAAAGATATTGCTTCGGCGTTGTGG
TGTTTCCATAGGGCATCAGAGAAGGGCCATGCTGGGGCAGCTATTTCATA
TGGATCTCTTCTTCTCAAAGGAGTCAAAATTCCAGAATCATTAATAAAGT
TCAGTTTGAAGAGAGGTTCGGCTGCTCAAATGCGAGGTAAGAACAAAGAA
AGTATTGCAATTGATCCAGTAGAGATGGCAAAAGAAAAATTTCAGATAGC
TGCAAAAGGAGGATGTGATCTTGGATTCAAATGGCTTGCAGGGTTAGAGG
AGGAAAAGAAGCGGTTACTCACCCAAGATTATTAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR006597Sel1-like
IPR011990Tetratricopeptide-like helical
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0005488binding