Overview
NameMedtr0039s0090.1
Unique NameMedtr0039s0090.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length663
Homology
BLAST of Medtr0039s0090.1 vs. NCBI nr
Match: gi|255563864|ref|XP_002522932.1| (conserved hypothetical protein [Ricinus communis] >gi|223537826|gb|EEF39443.1| conserved hypothetical protein [Ricinus communis])
BLAST of Medtr0039s0090.1 vs. NCBI nr
Match: gi|470147010|ref|XP_004309110.1| (PREDICTED: putative ribonuclease H protein At1g65750-like [Fragaria vesca subsp. vesca])
BLAST of Medtr0039s0090.1 vs. NCBI nr
Match: gi|470119812|ref|XP_004296004.1| (PREDICTED: putative ribonuclease H protein At1g65750-like [Fragaria vesca subsp. vesca])
BLAST of Medtr0039s0090.1 vs. NCBI nr
Match: gi|2244915|emb|CAB10337.1| (reverse transcriptase like protein [Arabidopsis thaliana] >gi|7268307|emb|CAB78601.1| reverse transcriptase like protein [Arabidopsis thaliana])
BLAST of Medtr0039s0090.1 vs. NCBI nr
Match: gi|470140013|ref|XP_004305739.1| (PREDICTED: uncharacterized protein LOC101306660 [Fragaria vesca subsp. vesca])
BLAST of Medtr0039s0090.1 vs. NCBI nr
Match: gi|356545263|ref|XP_003541064.1| (PREDICTED: uncharacterized protein LOC100796216 [Glycine max])
BLAST of Medtr0039s0090.1 vs. NCBI nr
Match: gi|6967113|emb|CAB72467.1| (putative protein [Arabidopsis thaliana])
BLAST of Medtr0039s0090.1 vs. NCBI nr
Match: gi|157086540|gb|ABV21212.1| (Ty1_Copia-element protein [Arabidopsis thaliana])
BLAST of Medtr0039s0090.1 vs. NCBI nr
Match: gi|87116463|dbj|BAE79384.1| (unnamed protein product [Ipomoea batatas])
BLAST of Medtr0039s0090.1 vs. NCBI nr
Match: gi|590576165|ref|XP_007012887.1| (Uncharacterized protein TCM_037692 [Theobroma cacao] >gi|508783250|gb|EOY30506.1| Uncharacterized protein TCM_037692 [Theobroma cacao])
The following BLAST results are available for this feature:
BLAST of Medtr0039s0090.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|255563864|ref|XP_002522932.1|5.638150e-1150.85conserved hypothetical protein [Ricinus communis] ... [more]
gi|470147010|ref|XP_004309110.1|3.534910e-944.44PREDICTED: putative ribonuclease H protein At1g657... [more]
gi|470119812|ref|XP_004296004.1|4.243680e-932.99PREDICTED: putative ribonuclease H protein At1g657... [more]
gi|2244915|emb|CAB10337.1|2.623220e-841.54reverse transcriptase like protein [Arabidopsis th... [more]
gi|470140013|ref|XP_004305739.1|2.777110e-846.43PREDICTED: uncharacterized protein LOC101306660 [F... [more]
gi|356545263|ref|XP_003541064.1|1.194250e-738.24PREDICTED: uncharacterized protein LOC100796216 [G... [more]
gi|6967113|emb|CAB72467.1|1.198290e-736.84putative protein [Arabidopsis thaliana][more]
gi|157086540|gb|ABV21212.1|1.669820e-740.58Ty1_Copia-element protein [Arabidopsis thaliana][more]
gi|87116463|dbj|BAE79384.1|2.309160e-736.49unnamed protein product [Ipomoea batatas][more]
gi|590576165|ref|XP_007012887.1|2.716460e-741.54Uncharacterized protein TCM_037692 [Theobroma caca... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableSEGsegsegcoord: 82..99
score: NAcoord: 162..178
score: NAcoord: 186..203
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0039s0090.1 ID=Medtr0039s0090.1|Name=Medtr0039s0090.1|organism=Medicago truncatula|type=mRNA|length=663bp
ATGTCTTTGATCAAGGATTTGGAAAAATCAATTAGAAACTTCATATGGAG
TGGCAGTATTGATAAAAGAAAGCTAGTCACAGTAGCTTGGAAAAAGATTT
GCAAACCAACTGCTCAAGGTGGGCTTGGCATCAGATCCTTGCAAAAGTTA
AATCAAGCAGCTAATCTTAAATTGTGCAGGGACCTGTTTCACAACAAAGA
AGATTGGGTTGGGCTTATTTGTCATACCCCAAATTTTGACCACTTTTCTC
TATTCTTATCCATTTTATTCGTATTTTTAAAGTCGAGCATTTTCATCGTT
TCAGACGAAATCTCGACAAAGAGATCTAGGGAGTTTTACTTTGATTTTGA
AAAAAATTTGAAAACGGAGAAGTTTCGTTTTCCGGTGTGGCGGCGCCGCC
CTGTTGGGCCGGCAAACCATCGCATCGGAGCGGCGAAACCTGCCGGAGAA
GATGAAGATCATCTTCTGCTCTTCTCCAGAATTTTTAGAGAGAAGGAAGA
GTTTTTTGGTTTAGAGAGAGAAAGGTTGAGAGAAATGAAGGTTGATGAAC
CGAATTTGCTTATATACTTGCTGTTGAACCGGTTTTTATTTCATTTGGAC
CGTTTTTTTAAAATCAAACCGGATTTCATTTTAACCGTTGGATCTCCGAT
CCTGTGGCTGTGA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated