Overview
NameMedtr0039s0080.1
Unique NameMedtr0039s0080.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1584
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0008150 biological_process
biological_process GO:0006812 cation transport
biological_process GO:0006855 drug transmembrane transport
biological_process GO:0051234 establishment of localization
biological_process GO:0006811 ion transport
biological_process GO:0051179 localization
biological_process GO:0015695 organic cation transport
biological_process GO:0071702 organic substance transport
biological_process GO:0044699 single-organism process
biological_process GO:0044765 single-organism transport
biological_process GO:0055085 transmembrane transport
biological_process GO:0006810 transport
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0009507 chloroplast
cellular_component GO:0005737 cytoplasm
cellular_component GO:0044444 cytoplasmic part
cellular_component GO:0005622 intracellular
cellular_component GO:0043231 intracellular membrane-bounded organelle
cellular_component GO:0043229 intracellular organelle
cellular_component GO:0044424 intracellular part
cellular_component GO:0016020 membrane
cellular_component GO:0043227 membrane-bounded organelle
cellular_component GO:0043226 organelle
cellular_component GO:0009536 plastid
molecular_function GO:0015297 antiporter activity
molecular_function GO:0015238 drug transmembrane transporter activity
molecular_function GO:0003674 molecular_function
molecular_function GO:0022857 transmembrane transporter activity
molecular_function GO:0005215 transporter activity
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF01554.1324241-24729270-4321-161131.11.9e-42233.76.7e-70

Homology
BLAST of Medtr0039s0080.1 vs. NCBI nr
Match: gi|502165759|ref|XP_004513681.1| (PREDICTED: multidrug and toxin extrusion protein 2-like [Cicer arietinum])
BLAST of Medtr0039s0080.1 vs. NCBI nr
Match: gi|356561709|ref|XP_003549122.1| (PREDICTED: multidrug and toxin extrusion protein 1-like [Glycine max])
BLAST of Medtr0039s0080.1 vs. NCBI nr
Match: gi|356534161|ref|XP_003535626.1| (PREDICTED: MATE efflux family protein 5-like [Glycine max])
BLAST of Medtr0039s0080.1 vs. NCBI nr
Match: gi|356574471|ref|XP_003555370.1| (PREDICTED: MATE efflux family protein 5-like [Glycine max])
BLAST of Medtr0039s0080.1 vs. NCBI nr
Match: gi|356529294|ref|XP_003533230.1| (PREDICTED: multidrug and toxin extrusion protein 2-like [Glycine max])
BLAST of Medtr0039s0080.1 vs. NCBI nr
Match: gi|502119393|ref|XP_004496604.1| (PREDICTED: multidrug and toxin extrusion protein 2-like [Cicer arietinum])
BLAST of Medtr0039s0080.1 vs. NCBI nr
Match: gi|596051890|ref|XP_007220655.1| (hypothetical protein PRUPE_ppa003689mg [Prunus persica] >gi|462417117|gb|EMJ21854.1| hypothetical protein PRUPE_ppa003689mg [Prunus persica])
BLAST of Medtr0039s0080.1 vs. NCBI nr
Match: gi|255539553|ref|XP_002510841.1| (multidrug resistance pump, putative [Ricinus communis] >gi|223549956|gb|EEF51443.1| multidrug resistance pump, putative [Ricinus communis])
BLAST of Medtr0039s0080.1 vs. NCBI nr
Match: gi|224136866|ref|XP_002322435.1| (predicted protein [Populus trichocarpa])
BLAST of Medtr0039s0080.1 vs. NCBI nr
Match: gi|225455459|ref|XP_002274808.1| (PREDICTED: multidrug and toxin extrusion protein 2-like [Vitis vinifera])
The following BLAST results are available for this feature:
BLAST of Medtr0039s0080.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502165759|ref|XP_004513681.1|0.000000e+082.89PREDICTED: multidrug and toxin extrusion protein 2... [more]
gi|356561709|ref|XP_003549122.1|0.000000e+075.49PREDICTED: multidrug and toxin extrusion protein 1... [more]
gi|356534161|ref|XP_003535626.1|0.000000e+073.18PREDICTED: MATE efflux family protein 5-like [Glyc... [more]
gi|356574471|ref|XP_003555370.1|0.000000e+071.80PREDICTED: MATE efflux family protein 5-like [Glyc... [more]
gi|356529294|ref|XP_003533230.1|0.000000e+076.61PREDICTED: multidrug and toxin extrusion protein 2... [more]
gi|502119393|ref|XP_004496604.1|0.000000e+070.75PREDICTED: multidrug and toxin extrusion protein 2... [more]
gi|596051890|ref|XP_007220655.1|0.000000e+068.87hypothetical protein PRUPE_ppa003689mg [Prunus per... [more]
gi|255539553|ref|XP_002510841.1|0.000000e+067.23multidrug resistance pump, putative [Ricinus commu... [more]
gi|224136866|ref|XP_002322435.1|0.000000e+069.03predicted protein [Populus trichocarpa][more]
gi|225455459|ref|XP_002274808.1|0.000000e+070.18PREDICTED: multidrug and toxin extrusion protein 2... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR002528Multi antimicrobial extrusion proteinTIGRFAMsTIGR00797matE: MATE efflux family proteincoord: 49..446
score: 4.8
NoneNo IPR availableCOILcoilcoiled-coilcoord: 484..505
score
NoneNo IPR availableSEGsegsegcoord: 116..130
score: NAcoord: 443..454
score: NAcoord: 483..495
score: NAcoord: 508..522
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0039s0080.1 ID=Medtr0039s0080.1|Name=Medtr0039s0080.1|organism=Medicago truncatula|type=mRNA|length=1584bp
ATGAGTGAAACAAATCCTAATCAATCAAACATGATCCTCACCAACCCTTT
GATTCCAAAACCAAAAAAAAACCAAACTTTTTCATTTTACCACCATCTTA
CACACACCTTCAAAGAAATGAATTCCATTTCAAAGATAGCTTTTCCAATG
ATCCTAACATGTCTTCTTCTATATTGTAGATCCATGATTTCAATGCTTTT
TCTTGGTCACCTCAATGACCTTGCACTAGCTGGTGGGTCCCTTGCTATTG
GTTTTGCCAACATCACTGGTTACTCCATTCTTTCTGGTCTTGCTGTTGGT
ATGGAACCAATTTGTGGTCAAGCTTTTGGTGCTAAAAAATTCACTCTTCT
TGGTCTTTGTCTTCAAAGAACCATTCTTTTGCTTCTTTTGGTTTCAATAC
CAATATCTTTTTCATGGCTTTACATGAAAAAAATGCTTTTGTTTTTTAAC
CAAGATGAAGAAATAGCAACAATGGCTCAAACTTATATTCTATATTCAAT
TCCTGATCTTATTGCTCAATCCTTTATACACCCTTTGAGAATTTACTTAA
GGACTCAATCCATTACTCTTCCTCTTACACTTTGTGCAACTTTTTCAATC
CTTCTTCACATACCAATAAATTATTTTCTTGTTATATATCTTAATTTGGG
TATAAAAGGAGTTGCTTTAAGTGGGGTATGGACAAATTTCAACCTTGTTG
CTTCTTTGATTTTCTACATTTATTATTCCGGCACACATAAAAAAACGTGG
GCCGGATTTTCTTTAGAGAGTTTCAGAGAGTGGTTGCCACTTTTAAACCT
CGCCATTCCAAGCTGCGTTTCTGTCTGCTTGGAATGGTGGTGGTATGAAT
TTATGACTATATTTTGTGGCTACTTAAGCAATCCAAGATCAAGTGTTGCA
TCAATGGGGGTGTTAATCCAAATTACTTCACTTATGTACATTTTTCCTTA
CTCACTAAGCAATAGTGTTTCAACAAGAGTTGGTAACATGATAGGTGCAC
AAAAGCCATCAAAAGCAAAACTTTCAGCAATTTCAGGACTTTCTTTCAGC
TTCATTTGTGGAGTGTTTGCATTTATTTTCACTCTTTGTGTAAGAAACAT
GTGGGCTAGTATGTTCACAAAAGACAAAGAAATCATTGCTTTAACATCAA
TGGTTTTGCCAATTATAGGTTTATGTGAACTAGGTAACTGTCCTCAAACA
ACAGGCTGTGGTGTTCTTAGAGGAACAGCAAGGCCTAAAGTTGGTGCTAA
TATCAACTTAGGTTGTTTTTATCTCGTCGGAATGCCGGTTTCGGTTTGGT
TAGCATTTTATGGTGGTTATGATTTTCAAGGTCTTTGGCTTGGTTTACTT
GCTGCTCAGGGATCATGTGCTCTTACTATGTTGATTGTTCTTTACAAAAC
TGATTGGAAATTTGAAGCTTTAAGAGCAAGGAAACTCACAGGATCAGAAA
AAGAGAATGAAAACAAAGAAATTGATGAAGAAAAGTTACATATTTCTGAA
AACAATGAAAATTCATTGCCATTTTTTGATGTTTTTGATGATTCAGATGA
AGATGATGAAGAAGAACGTTTGTGTTTGGTTTAG
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR002528Multi antimicrobial extrusion protein
noIPRunintegrated
Vocabulary: Biological Process
TermDefinition
GO:0006855drug transmembrane transport
GO:0055085transmembrane transport
GO:0006810transport
GO:0006811ion transport
GO:0006812cation transport
GO:0008150biological_process
GO:0015695organic cation transport
GO:0044699single-organism process
GO:0044765single-organism transport
GO:0051179localization
GO:0051234establishment of localization
GO:0071702organic substance transport
Vocabulary: Molecular Function
TermDefinition
GO:0015238drug transmembrane transporter activity
GO:0015297antiporter activity
GO:0003674molecular_function
GO:0005215transporter activity
GO:0022857transmembrane transporter activity
Vocabulary: Cellular Component
TermDefinition
GO:0016020membrane
GO:0005622intracellular
GO:0005575cellular_component
GO:0005623cell
GO:0005737cytoplasm
GO:0043231intracellular membrane-bounded organelle
GO:0009507chloroplast
GO:0009536plastid
GO:0043226organelle
GO:0043227membrane-bounded organelle
GO:0043229intracellular organelle
GO:0044424intracellular part
GO:0044444cytoplasmic part
GO:0044464cell part