Overview
NameMedtr0032s0090.1
Unique NameMedtr0032s0090.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length699
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF03372.1849842-504923-2192-24554.78.7e-1955.09.8e-15

Homology
BLAST of Medtr0032s0090.1 vs. NCBI nr
Match: gi|502151787|ref|XP_004508613.1| (PREDICTED: uncharacterized protein LOC101492921 [Cicer arietinum])
BLAST of Medtr0032s0090.1 vs. NCBI nr
Match: gi|356523531|ref|XP_003530391.1| (PREDICTED: uncharacterized protein LOC100804594 [Glycine max])
BLAST of Medtr0032s0090.1 vs. NCBI nr
Match: gi|332322201|emb|CCA66222.1| (hypothetical protein [Beta vulgaris subsp. vulgaris])
BLAST of Medtr0032s0090.1 vs. NCBI nr
Match: gi|147838411|emb|CAN74319.1| (hypothetical protein VITISV_035345 [Vitis vinifera])
BLAST of Medtr0032s0090.1 vs. NCBI nr
Match: gi|590642453|ref|XP_007030522.1| (Uncharacterized protein TCM_026293 [Theobroma cacao] >gi|508719127|gb|EOY11024.1| Uncharacterized protein TCM_026293 [Theobroma cacao])
BLAST of Medtr0032s0090.1 vs. NCBI nr
Match: gi|359486879|ref|XP_002273591.2| (PREDICTED: uncharacterized protein LOC100254784 [Vitis vinifera])
BLAST of Medtr0032s0090.1 vs. NCBI nr
Match: gi|147843817|emb|CAN83725.1| (hypothetical protein VITISV_037053 [Vitis vinifera])
BLAST of Medtr0032s0090.1 vs. NCBI nr
Match: gi|332322157|emb|CCA66153.1| (hypothetical protein [Beta vulgaris subsp. vulgaris])
BLAST of Medtr0032s0090.1 vs. NCBI nr
Match: gi|147798966|emb|CAN68165.1| (hypothetical protein VITISV_008538 [Vitis vinifera])
BLAST of Medtr0032s0090.1 vs. NCBI nr
Match: gi|147780533|emb|CAN69126.1| (hypothetical protein VITISV_008195 [Vitis vinifera])
The following BLAST results are available for this feature:
BLAST of Medtr0032s0090.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502151787|ref|XP_004508613.1|5.579030e-4543.52PREDICTED: uncharacterized protein LOC101492921 [C... [more]
gi|356523531|ref|XP_003530391.1|9.584860e-3436.49PREDICTED: uncharacterized protein LOC100804594 [G... [more]
gi|332322201|emb|CCA66222.1|3.134260e-2734.23hypothetical protein [Beta vulgaris subsp. vulgari... [more]
gi|147838411|emb|CAN74319.1|6.782300e-2332.58hypothetical protein VITISV_035345 [Vitis vinifera... [more]
gi|590642453|ref|XP_007030522.1|8.442280e-2332.71Uncharacterized protein TCM_026293 [Theobroma caca... [more]
gi|359486879|ref|XP_002273591.2|9.292210e-2332.58PREDICTED: uncharacterized protein LOC100254784 [V... [more]
gi|147843817|emb|CAN83725.1|9.423010e-2332.59hypothetical protein VITISV_037053 [Vitis vinifera... [more]
gi|332322157|emb|CCA66153.1|1.018020e-2231.19hypothetical protein [Beta vulgaris subsp. vulgari... [more]
gi|147798966|emb|CAN68165.1|1.244990e-2232.13hypothetical protein VITISV_008538 [Vitis vinifera... [more]
gi|147780533|emb|CAN69126.1|1.523440e-2232.46hypothetical protein VITISV_008195 [Vitis vinifera... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR005135Endonuclease/exonuclease/phosphataseSUPERFAMILY56219DNase I-likecoord: 2..221
score: 2.9
NoneNo IPR availableGENE3D3.60.10.10no descriptioncoord: 2..214
score: 1.5

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0032s0090.1 ID=Medtr0032s0090.1|Name=Medtr0032s0090.1|organism=Medicago truncatula|type=mRNA|length=699bp
ATGTTATCTTTTAATAGTAGGGGGCTAGGGGCGCCAGAGAAGAGGAGGGA
GATTAATTGGTTGGTTTCTGAGAGGAAGCCGACATTGTTATGTATACAAG
AATCGAAGTTGGAGGTGGTTGATGAGTTCTTGTGTCGCTCTCAGTGGGGG
TCTGCTCCAATGGGCTTTTATTTTAAATCTTCAGTTGGTGCGTCTGGTGG
CATTATTACGGTATGGGATCCTAGTGTGTTGAATGTTTGGATGACTGTAA
ACATTGCAAATTGCTTGATAATCAAAGGGACGTTCATAAAAAATAATGAA
GTGTTTTGTTTGGCAAATATTTATGCTCCTTGTGATAATAGGGGGCGACA
GGTTCTGTGGGACGCTGTCTCTAATTTGCTACTATTACACGGTGATGTGG
CTTGGTTTGTGCTTGGCGACTTTAATGTCGTTCGTTCTAGTGAAGAAAGA
AGAGGCCGTTTTGAAAATACCTTTTATGTTGACTATGCTCCTTTTAATCA
GTTCATTGACGGTAATTTTCTCATTGATTCACCTTTATGTGGTCACAATT
TTACCTGGTATCGGGGAGATGGTGTATCGATGAGTCATCTAGATCGGTTT
TTATTATTAGAATCATGGACAACTCTATTTCCTAATTGTATCCAAGTTGC
TCTTCCTAGATCGGTCCCAAAACTTGTTTCACGTAAAACGTTTCTCTAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR005135Endonuclease/exonuclease/phosphatase
noIPRunintegrated