Overview
NameMedtr0031s0120.1
Unique NameMedtr0031s0120.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1170
Homology
BLAST of Medtr0031s0120.1 vs. NCBI nr
Match: gi|590608283|ref|XP_007021221.1| (Uncharacterized protein TCM_031281 [Theobroma cacao] >gi|508720849|gb|EOY12746.1| Uncharacterized protein TCM_031281 [Theobroma cacao])
The following BLAST results are available for this feature:
BLAST of Medtr0031s0120.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 1
Match NameE-valueIdentityDescription
gi|590608283|ref|XP_007021221.1|1.143760e-427.86Uncharacterized protein TCM_031281 [Theobroma caca... [more]
back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableSEGsegsegcoord: 85..101
score: NAcoord: 368..383
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0031s0120.1 ID=Medtr0031s0120.1|Name=Medtr0031s0120.1|organism=Medicago truncatula|type=mRNA|length=1170bp
ATGTTTGGTTCGGTGATTGTCGTGTTTGGGCTCGTGAAGCGAGGTTTGAC
AAGTTTGCACATTGAAGGGGAAGCTAGGGTTGTGAATGCTGTAGGGATGG
AGGAGGGAGGAAAGGATTCGGTTTTTATTGTGGTTAAGAGTGATGGAATA
AGAAATGTCAGAATCGCAAAACAGAAGGAGGTTGTACAGGGCGTTGGGGC
GGTTTCTTTGAGAGTGGGGGATGTTGACGTACCAGTCGGAGGTCAGGAGA
GGGGAGCGAAGGTCAAAAAAGTGGCTGTGGTGGAGAAGAATGCGGGAGGG
AAGGAGGTGGCAGAGGTGAGCAAGAGTACGGATCAGGTTGGTGTGGCGGA
AGGCATGGATGGTCCTAGCAAGTCTATTCGTTGCGAGATGAAGAGAAAGG
AGGCTGATACGTCAGTGATTGTTAAGGAGCAGCAACGATCACACTACATT
CCAGTATTTCATTCTCGAAGCCAAGACTTGAAATGGGCTCATTCTGGTTT
GGTCGCAACGGTGTTGGAGGAGGAGTCGACATTAGCTATTCAACAAAAAA
TGGAGGATGCTGGTTTTCCCAAAGTTGTCATTACACCAATCGGGGGGGAT
CGTGTGTTTCTTCATTGTAATGAAGGTGAGGAAATGTGGACAATTTTCAA
TGACGCTATTCATTTCTTTGGGATGATGTTTAGTACAATTAGAAAGTGGT
CGCCGTCGGAGGTTATGTATGAACGGGGAGCTTGGTTGCATGTTTATGGA
ATTCCTATTAATGCTAGATTTATACGTTCTGATGAATGCACGGTTGATAA
GGCAAGGTTGGATTTTGCACGTGTTCTTATTTCGACACCACATATAGAAA
TTGCGAACACAACAGCTGCATTTCTTATTGATAACTGTAATTACATTGTT
ATGTTGGTGGAGGAGTGGGGATGCAACTTGGGTGAGGATGCATTTATGAC
GGAGGAGGTGATCGATTCAAGACCAGAAACTTTGTCGAATCCGAGTAATG
TGAATGACTTAGATATGGTGCAAGGGGAGTGGGAGTTGGATGAGTTGGTC
ACTGATTTGCATAGAGAATGGGGGGATCATGGAGGGCAGCATGTTGGGTC
AAATACTAAACAAAATTTATGTCAGAACCAGCAAACTAATTGTAACACCT
CGTTACCCAAAAGCAATTAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated