Overview
NameMedtr0030s0400.1
Unique NameMedtr0030s0400.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length426
Homology
BLAST of Medtr0030s0400.1 vs. NCBI nr
Match: gi|460389331|ref|XP_004240309.1| (PREDICTED: uncharacterized protein LOC101266943 [Solanum lycopersicum])
BLAST of Medtr0030s0400.1 vs. NCBI nr
Match: gi|460365951|ref|XP_004228857.1| (PREDICTED: uncharacterized protein LOC101244312 [Solanum lycopersicum])
BLAST of Medtr0030s0400.1 vs. NCBI nr
Match: gi|460384126|ref|XP_004237765.1| (PREDICTED: uncharacterized protein LOC101246920 [Solanum lycopersicum])
BLAST of Medtr0030s0400.1 vs. NCBI nr
Match: gi|460399729|ref|XP_004245389.1| (PREDICTED: uncharacterized protein LOC101247947 [Solanum lycopersicum])
The following BLAST results are available for this feature:
BLAST of Medtr0030s0400.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 4
Match NameE-valueIdentityDescription
gi|460389331|ref|XP_004240309.1|2.777200e-628.95PREDICTED: uncharacterized protein LOC101266943 [S... [more]
gi|460365951|ref|XP_004228857.1|5.576180e-626.45PREDICTED: uncharacterized protein LOC101244312 [S... [more]
gi|460384126|ref|XP_004237765.1|2.766460e-525.81PREDICTED: uncharacterized protein LOC101246920 [S... [more]
gi|460399729|ref|XP_004245389.1|1.046630e-429.29PREDICTED: uncharacterized protein LOC101247947 [S... [more]
back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
BlastP Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0030s0400.1 ID=Medtr0030s0400.1|Name=Medtr0030s0400.1|organism=Medicago truncatula|type=mRNA|length=426bp
ATGGAAGCCTCCAAGATACGTCACTTACCGCATGAAGAGGAGTTGGTCCA
AACTCTCATCAGGTCACTTGAGGGTATATACTACAAAACCCTGTTCTTCG
CTGGTATTCCAAGTTTCAACAATCTAATTCGAATTGGAAAAGAGTTAGAA
TATAACATTCAATCTGGAAGAATTACTCATACACAAATTCCTCTTCAAGT
CCTGAAAAAATCATTAGATGAAAGGAACAAAGATGCATCAACCTATATAC
CTCCAAAACAAAGAAATCAGAATATTGAGCAAGTTCATGCTATTCTTGAG
CCTTGGAACCCGCAGGTATCTCAAAATAAGGTGAGGAAACCTCGTGTATT
CACTCCCTTAAGGGAAACTTTGGCCGACATTTTCCAGAGATTATGGGCTA
AAGGACTTTTAAGACCAAGAAATTGA
back to top