Overview
NameMedtr0029s0220.1
Unique NameMedtr0029s0220.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length387
Homology
BLAST of Medtr0029s0220.1 vs. NCBI nr
Match: gi|4417306|gb|AAD20430.1| (putative Athila retroelement ORF1 protein [Arabidopsis thaliana])
BLAST of Medtr0029s0220.1 vs. NCBI nr
Match: gi|32487720|emb|CAE05397.1| (OSJNBa0022F16.21 [Oryza sativa Japonica Group])
BLAST of Medtr0029s0220.1 vs. NCBI nr
Match: gi|7682801|gb|AAF67381.1| (Hypothetical protein T15F17.m [Arabidopsis thaliana])
BLAST of Medtr0029s0220.1 vs. NCBI nr
Match: gi|19881641|gb|AAM01042.1|AC091735_15 (Putative polyprotein [Oryza sativa Japonica Group] >gi|31430941|gb|AAP52786.1| Zinc knuckle family protein [Oryza sativa Japonica Group])
BLAST of Medtr0029s0220.1 vs. NCBI nr
Match: gi|7523689|gb|AAF63128.1|AC009526_13 (Similar to Athila ORF 1 [Arabidopsis thaliana])
BLAST of Medtr0029s0220.1 vs. NCBI nr
Match: gi|62701698|gb|AAX92771.1| (Transposable element protein, putative [Oryza sativa Japonica Group] >gi|77550518|gb|ABA93315.1| Transposable element protein, putative, Retrotrans_gag [Oryza sativa Japonica Group])
BLAST of Medtr0029s0220.1 vs. NCBI nr
Match: gi|38344353|emb|CAD40175.2| (OSJNBa0061A09.14 [Oryza sativa Japonica Group])
BLAST of Medtr0029s0220.1 vs. NCBI nr
Match: gi|3319352|gb|AAC26241.1| (F9D12.15 gene product [Arabidopsis thaliana])
BLAST of Medtr0029s0220.1 vs. NCBI nr
Match: gi|1666236|gb|AAB18645.1| (unknown [Hordeum vulgare])
BLAST of Medtr0029s0220.1 vs. NCBI nr
Match: gi|77555192|gb|ABA97988.1| (Transposable element protein, putative, Retrotrans_gag [Oryza sativa Japonica Group])
The following BLAST results are available for this feature:
BLAST of Medtr0029s0220.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|4417306|gb|AAD20430.1|6.893830e-1342.70putative Athila retroelement ORF1 protein [Arabido... [more]
gi|32487720|emb|CAE05397.1|9.648060e-1343.33OSJNBa0022F16.21 [Oryza sativa Japonica Group][more]
gi|7682801|gb|AAF67381.1|1.566930e-1245.24Hypothetical protein T15F17.m [Arabidopsis thalian... [more]
gi|19881641|gb|AAM01042.1|AC091735_152.787490e-1242.05Putative polyprotein [Oryza sativa Japonica Group]... [more]
gi|7523689|gb|AAF63128.1|AC009526_135.423940e-1249.30Similar to Athila ORF 1 [Arabidopsis thaliana][more]
gi|62701698|gb|AAX92771.1|1.302290e-1142.05Transposable element protein, putative [Oryza sati... [more]
gi|38344353|emb|CAD40175.2|1.502810e-1139.77OSJNBa0061A09.14 [Oryza sativa Japonica Group][more]
gi|3319352|gb|AAC26241.1|1.528010e-1142.05F9D12.15 gene product [Arabidopsis thaliana][more]
gi|1666236|gb|AAB18645.1|1.724080e-1139.33unknown [Hordeum vulgare][more]
gi|77555192|gb|ABA97988.1|2.310860e-1140.91Transposable element protein, putative, Retrotrans... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
BlastP Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0029s0220.1 ID=Medtr0029s0220.1|Name=Medtr0029s0220.1|organism=Medicago truncatula|type=mRNA|length=387bp
ATGCCAAGTACTCGATCATCTGAGGACAATCTAGAGCAACCAATCGACGA
AATCGAACGTTTTTTACATATTAGACGCCAAGTTGAACGAATACACGCTC
AAATGGCACTAGCTCATAACGCGAACCGTCCTCTTAAGGACTTTGCCGTC
CCATCCCAGGACGAGCCTCACTCAAGTATTGTTAACCCGACGATTCAGGC
TAACAACTTCGAGTTGAAACCTTCTCTGTTGCAAATCGTGCAACAAAACC
AGTTTTCCGGTAATTCTACGGAAGACCCGAATTTGCACCTATCCGTGTTC
GTGCAATTTGCTGATACGCTTAAGTGCAATGGCGTCGATCCCGAAGCCAT
TCGCCTGCGTTTATTCCCTTTCTCCCTCAGAGACTGA
back to top