Overview
NameMedtr0029s0220.1
Unique NameMedtr0029s0220.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length387
Homology
BLAST of Medtr0029s0220.1 vs. NCBI nr
Match: gi|590635177|ref|XP_007028564.1| (Uncharacterized protein TCM_024420 [Theobroma cacao] >gi|508717169|gb|EOY09066.1| Uncharacterized protein TCM_024420 [Theobroma cacao])
BLAST of Medtr0029s0220.1 vs. NCBI nr
Match: gi|147820793|emb|CAN69639.1| (hypothetical protein VITISV_040272 [Vitis vinifera])
BLAST of Medtr0029s0220.1 vs. NCBI nr
Match: gi|147770960|emb|CAN69709.1| (hypothetical protein VITISV_018584 [Vitis vinifera])
BLAST of Medtr0029s0220.1 vs. NCBI nr
Match: gi|261865353|gb|ACY01934.1| (hypothetical protein [Beta vulgaris])
BLAST of Medtr0029s0220.1 vs. NCBI nr
Match: gi|590651980|ref|XP_007033035.1| (Integrase-like protein [Theobroma cacao] >gi|508712064|gb|EOY03961.1| Integrase-like protein [Theobroma cacao])
BLAST of Medtr0029s0220.1 vs. NCBI nr
Match: gi|595835097|ref|XP_007206984.1| (hypothetical protein PRUPE_ppb020528mg, partial [Prunus persica] >gi|462402626|gb|EMJ08183.1| hypothetical protein PRUPE_ppb020528mg, partial [Prunus persica])
BLAST of Medtr0029s0220.1 vs. NCBI nr
Match: gi|502146293|ref|XP_004506389.1| (PREDICTED: uncharacterized protein LOC101489118 [Cicer arietinum])
BLAST of Medtr0029s0220.1 vs. NCBI nr
Match: gi|596027311|ref|XP_007219241.1| (hypothetical protein PRUPE_ppa017823mg, partial [Prunus persica] >gi|462415703|gb|EMJ20440.1| hypothetical protein PRUPE_ppa017823mg, partial [Prunus persica])
BLAST of Medtr0029s0220.1 vs. NCBI nr
Match: gi|4417310|gb|AAD20434.1| (putative Athila retroelement ORF1 protein [Arabidopsis thaliana])
BLAST of Medtr0029s0220.1 vs. NCBI nr
Match: gi|590616777|ref|XP_007023601.1| (Uncharacterized protein TCM_027661 [Theobroma cacao] >gi|508778967|gb|EOY26223.1| Uncharacterized protein TCM_027661 [Theobroma cacao])
The following BLAST results are available for this feature:
BLAST of Medtr0029s0220.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|590635177|ref|XP_007028564.1|4.228180e-2154.55Uncharacterized protein TCM_024420 [Theobroma caca... [more]
gi|147820793|emb|CAN69639.1|6.198460e-1851.16hypothetical protein VITISV_040272 [Vitis vinifera... [more]
gi|147770960|emb|CAN69709.1|3.032890e-1752.33hypothetical protein VITISV_018584 [Vitis vinifera... [more]
gi|261865353|gb|ACY01934.1|8.249210e-1746.74hypothetical protein [Beta vulgaris][more]
gi|590651980|ref|XP_007033035.1|8.013830e-1650.00Integrase-like protein [Theobroma cacao] >gi|50871... [more]
gi|595835097|ref|XP_007206984.1|1.347920e-1433.67hypothetical protein PRUPE_ppb020528mg, partial [P... [more]
gi|502146293|ref|XP_004506389.1|4.267630e-1451.39PREDICTED: uncharacterized protein LOC101489118 [C... [more]
gi|596027311|ref|XP_007219241.1|1.074930e-1340.70hypothetical protein PRUPE_ppa017823mg, partial [P... [more]
gi|4417310|gb|AAD20434.1|4.304130e-1343.18putative Athila retroelement ORF1 protein [Arabido... [more]
gi|590616777|ref|XP_007023601.1|4.358450e-1339.09Uncharacterized protein TCM_027661 [Theobroma caca... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
BlastP Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0029s0220.1 ID=Medtr0029s0220.1|Name=Medtr0029s0220.1|organism=Medicago truncatula|type=mRNA|length=387bp
ATGCCAAGTACTCGATCATCTGAGGACAATCTAGAGCAACCAATCGACGA
AATCGAACGTTTTTTACATATTAGACGCCAAGTTGAACGAATACACGCTC
AAATGGCACTAGCTCATAACGCGAACCGTCCTCTTAAGGACTTTGCCGTC
CCATCCCAGGACGAGCCTCACTCAAGTATTGTTAACCCGACGATTCAGGC
TAACAACTTCGAGTTGAAACCTTCTCTGTTGCAAATCGTGCAACAAAACC
AGTTTTCCGGTAATTCTACGGAAGACCCGAATTTGCACCTATCCGTGTTC
GTGCAATTTGCTGATACGCTTAAGTGCAATGGCGTCGATCCCGAAGCCAT
TCGCCTGCGTTTATTCCCTTTCTCCCTCAGAGACTGA
back to top