Overview
NameMedtr0029s0180.1
Unique NameMedtr0029s0180.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length372
Homology
BLAST of Medtr0029s0180.1 vs. NCBI nr
Match: gi|356554623|ref|XP_003545644.1| (PREDICTED: uncharacterized protein LOC100789762 [Glycine max])
BLAST of Medtr0029s0180.1 vs. NCBI nr
Match: gi|356560241|ref|XP_003548402.1| (PREDICTED: uncharacterized protein LOC100788372 [Glycine max])
BLAST of Medtr0029s0180.1 vs. NCBI nr
Match: gi|356540662|ref|XP_003538805.1| (PREDICTED: uncharacterized protein LOC100806642 [Glycine max])
BLAST of Medtr0029s0180.1 vs. NCBI nr
Match: gi|356553674|ref|XP_003545178.1| (PREDICTED: uncharacterized protein LOC100783555 [Glycine max])
BLAST of Medtr0029s0180.1 vs. NCBI nr
Match: gi|356566644|ref|XP_003551540.1| (PREDICTED: uncharacterized protein LOC100776668 [Glycine max])
BLAST of Medtr0029s0180.1 vs. NCBI nr
Match: gi|356532475|ref|XP_003534798.1| (PREDICTED: uncharacterized protein LOC100806767 [Glycine max])
BLAST of Medtr0029s0180.1 vs. NCBI nr
Match: gi|356562251|ref|XP_003549385.1| (PREDICTED: uncharacterized protein LOC100784663 [Glycine max])
BLAST of Medtr0029s0180.1 vs. NCBI nr
Match: gi|356503081|ref|XP_003520340.1| (PREDICTED: uncharacterized protein LOC100788952 [Glycine max])
BLAST of Medtr0029s0180.1 vs. NCBI nr
Match: gi|356506259|ref|XP_003521904.1| (PREDICTED: uncharacterized protein LOC100796526 [Glycine max])
BLAST of Medtr0029s0180.1 vs. NCBI nr
Match: gi|356502140|ref|XP_003519879.1| (PREDICTED: uncharacterized protein LOC100786989 [Glycine max])
The following BLAST results are available for this feature:
BLAST of Medtr0029s0180.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|356554623|ref|XP_003545644.1|1.733530e-1440.34PREDICTED: uncharacterized protein LOC100789762 [G... [more]
gi|356560241|ref|XP_003548402.1|1.837610e-1440.34PREDICTED: uncharacterized protein LOC100788372 [G... [more]
gi|356540662|ref|XP_003538805.1|1.934320e-1440.34PREDICTED: uncharacterized protein LOC100806642 [G... [more]
gi|356553674|ref|XP_003545178.1|1.969890e-1440.34PREDICTED: uncharacterized protein LOC100783555 [G... [more]
gi|356566644|ref|XP_003551540.1|2.128380e-1440.34PREDICTED: uncharacterized protein LOC100776668 [G... [more]
gi|356532475|ref|XP_003534798.1|2.199780e-1440.34PREDICTED: uncharacterized protein LOC100806767 [G... [more]
gi|356562251|ref|XP_003549385.1|2.241630e-1440.34PREDICTED: uncharacterized protein LOC100784663 [G... [more]
gi|356503081|ref|XP_003520340.1|2.241630e-1440.34PREDICTED: uncharacterized protein LOC100788952 [G... [more]
gi|356506259|ref|XP_003521904.1|2.297650e-1440.34PREDICTED: uncharacterized protein LOC100796526 [G... [more]
gi|356502140|ref|XP_003519879.1|2.473380e-1437.82PREDICTED: uncharacterized protein LOC100786989 [G... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
BlastP Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0029s0180.1 ID=Medtr0029s0180.1|Name=Medtr0029s0180.1|organism=Medicago truncatula|type=mRNA|length=372bp
ATGCAACTCGATGCCGAACCTTCGAAGAAAGCTGATTCCATGTATGCCGA
AGTAATCGGCATAAACATGGTAGATGTCACAGAAGCAGTTGATAACGAAC
TACCCATCGGAGCGCAGTCACTTAAAGAAACTTCGCCAAATGATGTCGAA
ATGGTTGTTGAAGATCATCAATTCGATGATATGATGGTCACTGAAGTCCA
ATTCACTGAAAATATGAAAGTGCCATATCCTAAAGCTGGGGAAGATCTTG
TTGATTTTTTCAACCGCTGCAAGATTTCCAACACCAATGCCATGCTTTGT
CCAAGATGCAGCGCGGTTTTCGACAAAGAGGCCGCAAAATTTATTGAGGG
GTTCCAACCAGACGAAGTGTAA
back to top