Overview
NameMedtr0029s0140.1
Unique NameMedtr0029s0140.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1197
Homology
BLAST of Medtr0029s0140.1 vs. NCBI nr
Match: gi|356541928|ref|XP_003539424.1| (PREDICTED: uncharacterized protein LOC100790056 [Glycine max])
The following BLAST results are available for this feature:
BLAST of Medtr0029s0140.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 1
Match NameE-valueIdentityDescription
gi|356541928|ref|XP_003539424.1|1.594290e-3653.13PREDICTED: uncharacterized protein LOC100790056 [G... [more]
back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableCOILcoilcoiled-coilcoord: 342..363
score
NoneNo IPR availableSEGsegsegcoord: 37..57
score: NAcoord: 77..161
score: NAcoord: 164..173
score: NAcoord: 269..284
score: NAcoord: 387..398
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0029s0140.1 ID=Medtr0029s0140.1|Name=Medtr0029s0140.1|organism=Medicago truncatula|type=mRNA|length=1197bp
ATGCCTCCGAAACAAAAACAAAAGAGCAAGGGCAATAACAGGAAGAAGTA
TACTACTCACATTGTGGACGCAGCAACAGAAGCTAGATTAAACCCCATGC
CTAACATTTCTACTGCATCTTCTAGCCAGGGATCACCTGGGTCCTCCCAG
GCTAGTGTAGCTGCCCCCGCTATGGGTTCTGCTCCTCCTCCCACTTACAT
ATACCCTCCATTACATCTAGGATATTATGGCACCGTACCTCCTTTTGGGA
CATTCCCTCCTCCGAGCTATCAGTTCCCACCATATTCAATCCCACCACAA
AACCATCCCCTTCCCCAACAACAACAAATCCCTCCACAGCAAAACCCACC
CTTTCCGCAACAACAACAAATCCCTCCACAACAAAACTCACCATTTCCCC
AACAACAAATCCCTCCACAACAAAACCCACCTTTTCCCCAACAACAACAA
AACCCACCACAACCCCAACAACAACCCCAACAAGAAAATGTGGTCGAAGA
GGGTGGTGGAGAGCTGGTGATGTTTCATGATGTTATCCCGGATTATCCGA
GAGATTCTCTTCGTCGATACATCTTAAAGCCTAGTGGAAACAGCTTTTTA
CCTTGCAAACCGGCTGCCGAAGCAATCAAATCCATCATTCATAACTGCTA
TGGTCACTTTTGGAAGACATATGGTGACCTGGATGATAATGAGAAAGATC
GCTGGTTTAGTATACTAATTGTTATAGAGGAGTATGACCGGCAGCTTGCT
GAGGCTATTTCTCAAGGGTCTACTATTGATCACTCTTTGACCTTCAACAC
TTGGAAAAAAGTTGTCGGCGACAAGAAGAAAGGAAAGCTCTATGGCCTTG
GTAACTTAGCCGCTAACTATCGGAAGGGAAGTGTTGCATCAACCCTCAGA
CTAACCCTCAATCAGGGTGAAGGAACCTCCCAGCAGCCTCAGCTGACGCC
AGAGATGCGGGAGCTCATTCATAGATTGTCACAAGAGCAGTTCTCGCAGC
AGATGGCAAGTCAAGCAGCCCTTGTGCAAGAATTGATTAACCGCCAAAGA
TTATACGAGGAGCAGCTGACTCGACTTATGCAAGCACAGGATCAAGCTCC
CTCCCACACTCAAGCGCCGGTTTTAAGTCCGAATGTTGAGCCTTATCCCG
TATATAAGGAGGATGATGTGGACGATGCGGATGATGTTGAGGATTGA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated