Overview
NameMedtr0029s0100.1
Unique NameMedtr0029s0100.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1080
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0008150 biological_process
biological_process GO:0016043 cellular component organization
biological_process GO:0071840 cellular component organization or biogenesis
biological_process GO:0051641 cellular localization
biological_process GO:0070727 cellular macromolecule localization
biological_process GO:0009987 cellular process
biological_process GO:0034613 cellular protein localization
biological_process GO:0016482 cytoplasmic transport
biological_process GO:0007029 endoplasmic reticulum organization
biological_process GO:0051234 establishment of localization
biological_process GO:0051649 establishment of localization in cell
biological_process GO:0045184 establishment of protein localization
biological_process GO:0006886 intracellular protein transport
biological_process GO:0046907 intracellular transport
biological_process GO:0051179 localization
biological_process GO:0033036 macromolecule localization
biological_process GO:0006996 organelle organization
biological_process GO:0071702 organic substance transport
biological_process GO:0032527 protein exit from endoplasmic reticulum
biological_process GO:0008104 protein localization
biological_process GO:0015031 protein transport
biological_process GO:0044699 single-organism process
biological_process GO:0044765 single-organism transport
biological_process GO:0006810 transport
cellular_component GO:0005575 cellular_component
cellular_component GO:0005576 extracellular region
cellular_component GO:0044421 extracellular region part
cellular_component GO:0005615 extracellular space
molecular_function GO:0004560 alpha-L-fucosidase activity
molecular_function GO:0003824 catalytic activity
molecular_function GO:0015928 fucosidase activity
molecular_function GO:0016787 hydrolase activity
molecular_function GO:0016798 hydrolase activity, acting on glycosyl bonds
molecular_function GO:0004553 hydrolase activity, hydrolyzing O-glycosyl compounds
molecular_function GO:0003674 molecular_function
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00657.1744703-4378032-3392-23284.08.6e-2884.58.5e-24

Homology
BLAST of Medtr0029s0100.1 vs. NCBI nr
Match: gi|502101745|ref|XP_004491864.1| (PREDICTED: GDSL esterase/lipase At5g45910-like [Cicer arietinum])
BLAST of Medtr0029s0100.1 vs. NCBI nr
Match: gi|502154159|ref|XP_004509605.1| (PREDICTED: GDSL esterase/lipase At5g45910-like [Cicer arietinum])
BLAST of Medtr0029s0100.1 vs. NCBI nr
Match: gi|363814465|ref|NP_001242867.1| (uncharacterized protein LOC100794616 precursor [Glycine max] >gi|255636210|gb|ACU18446.1| unknown [Glycine max])
BLAST of Medtr0029s0100.1 vs. NCBI nr
Match: gi|502179556|ref|XP_004516452.1| (PREDICTED: GDSL esterase/lipase At5g45910-like [Cicer arietinum])
BLAST of Medtr0029s0100.1 vs. NCBI nr
Match: gi|502155447|ref|XP_004510075.1| (PREDICTED: GDSL esterase/lipase At5g45910-like [Cicer arietinum])
BLAST of Medtr0029s0100.1 vs. NCBI nr
Match: gi|502179561|ref|XP_004516453.1| (PREDICTED: GDSL esterase/lipase At5g45910-like [Cicer arietinum])
BLAST of Medtr0029s0100.1 vs. NCBI nr
Match: gi|502173896|ref|XP_004515399.1| (PREDICTED: GDSL esterase/lipase At5g45910-like, partial [Cicer arietinum])
BLAST of Medtr0029s0100.1 vs. NCBI nr
Match: gi|356537132|ref|XP_003537084.1| (PREDICTED: GDSL esterase/lipase At5g45910-like [Glycine max])
BLAST of Medtr0029s0100.1 vs. NCBI nr
Match: gi|356570261|ref|XP_003553308.1| (PREDICTED: GDSL esterase/lipase At5g45910-like [Glycine max])
BLAST of Medtr0029s0100.1 vs. NCBI nr
Match: gi|356508651|ref|XP_003523068.1| (PREDICTED: LOW QUALITY PROTEIN: GDSL esterase/lipase At5g45910-like [Glycine max])
The following BLAST results are available for this feature:
BLAST of Medtr0029s0100.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502101745|ref|XP_004491864.1|1.672010e-17867.83PREDICTED: GDSL esterase/lipase At5g45910-like [Ci... [more]
gi|502154159|ref|XP_004509605.1|6.359440e-17566.13PREDICTED: GDSL esterase/lipase At5g45910-like [Ci... [more]
gi|363814465|ref|NP_001242867.1|1.699880e-17165.59uncharacterized protein LOC100794616 precursor [Gl... [more]
gi|502179556|ref|XP_004516452.1|3.547540e-16964.27PREDICTED: GDSL esterase/lipase At5g45910-like [Ci... [more]
gi|502155447|ref|XP_004510075.1|4.860030e-16864.00PREDICTED: GDSL esterase/lipase At5g45910-like [Ci... [more]
gi|502179561|ref|XP_004516453.1|6.041410e-16865.41PREDICTED: GDSL esterase/lipase At5g45910-like [Ci... [more]
gi|502173896|ref|XP_004515399.1|4.657110e-16663.96PREDICTED: GDSL esterase/lipase At5g45910-like, pa... [more]
gi|356537132|ref|XP_003537084.1|3.592400e-16263.71PREDICTED: GDSL esterase/lipase At5g45910-like [Gl... [more]
gi|356570261|ref|XP_003553308.1|3.679190e-16263.27PREDICTED: GDSL esterase/lipase At5g45910-like [Gl... [more]
gi|356508651|ref|XP_003523068.1|4.803770e-15662.20PREDICTED: LOW QUALITY PROTEIN: GDSL esterase/lipa... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0029s0100.1 ID=Medtr0029s0100.1|Name=Medtr0029s0100.1|organism=Medicago truncatula|type=mRNA|length=1080bp
ATGAATGTATCCACTCTCTTCCTCATCACCTTCACATGTGGTTTTCTACA
AAATGTAGTTTCAAATGCAAATCCTCTCTCATATGAAGCTTTCTTTAACT
TTGGTGATTCTATAAGTGACACTGGAAATGCTGCATCTATCTTTCTACCT
ATGCCTAACCCTATTCCTTATGGTTCTAGTTACTTTAAACATCCTTCAGG
ACGTATGTCAAATGGACGACTGATCATAGATTTTATTGCCGAGGCATATG
GGTTGCCGTTTTTGCCTGCCTATGAGAATAAAAGCATAGACCAAGATATC
AAAAAAGGAGTAAATTTTGCATTTGCTGGTGCCACTGTGCTCAATGTTGA
GTATTATGTCAAAAACGGGCTTCCTCTTCCAGATACAAATAACTCATTGA
GCATTCAACTTGGATGGTTCAAGAATATCAAACCCCTCCTCTGTAAAAGC
AAAGAAGATTGCAATATCTACTTCAAGAAATCATTGTTTATAGTTGGAGA
AATTGGTGGGAACGATATTATGAAGCATATGAAGCATAAAACTGTTATAG
AACTTCGAGAAATAGTTCCCTTTATGGTTAAAGCCATTACTAACACCACA
AATGTGCTAATCGAAGAAGGAGCTGTAGAGCTAGTGGTACCTGGGAATTT
TCCGATGGGATGCAGTGCTGCAATGTTCACATTGGTGAATAGTAATAAGA
AAGAAGACTATGATGAATTTGGGTGCTTAATAGCTTACAATAATTTAATA
GAGTACTTTAACGGGCAACTAAAAAATTCTATAGAGACACTAAGACAGAA
GCACCCTGAAGTTAAGATAATATACTTTGACTACTATAATGATGCCAAAT
GTTTATATCAAACACCGCAACAATATGGTTTTGATAAGGATGCTATTTTC
AAAGCATGTTGTGGAGGATGTGGATCACTTATCGCTACAGTTTGCTCTGA
TCCTTCAAAACGTATAAATTGGGACGGACCACACTTTACTGAAGCAGCTT
ATAAGCTAATAGCAAAAGGGCTAGTTGAGGGTCCATTTTCAAATCCTTCT
CTTAAATCCCCTCTTTTCAAAATAGCTTAG
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: Cellular Component
TermDefinition
GO:0005575cellular_component
GO:0005576extracellular region
GO:0005615extracellular space
GO:0044421extracellular region part
Vocabulary: Molecular Function
TermDefinition
GO:0003674molecular_function
GO:0003824catalytic activity
GO:0004553hydrolase activity, hydrolyzing O-glycosyl compounds
GO:0004560alpha-L-fucosidase activity
GO:0015928fucosidase activity
GO:0016787hydrolase activity
GO:0016798hydrolase activity, acting on glycosyl bonds
Vocabulary: Biological Process
TermDefinition
GO:0008104protein localization
GO:0006810transport
GO:0006886intracellular protein transport
GO:0006996organelle organization
GO:0007029endoplasmic reticulum organization
GO:0008150biological_process
GO:0009987cellular process
GO:0015031protein transport
GO:0016043cellular component organization
GO:0016482cytoplasmic transport
GO:0032527protein exit from endoplasmic reticulum
GO:0033036macromolecule localization
GO:0034613cellular protein localization
GO:0044699single-organism process
GO:0044765single-organism transport
GO:0045184establishment of protein localization
GO:0046907intracellular transport
GO:0051179localization
GO:0051234establishment of localization
GO:0051641cellular localization
GO:0051649establishment of localization in cell
GO:0070727cellular macromolecule localization
GO:0071702organic substance transport
GO:0071840cellular component organization or biogenesis