Overview
NameMedtr0029s0060.1
Unique NameMedtr0029s0060.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1416
Homology
BLAST of Medtr0029s0060.1 vs. NCBI nr
Match: gi|260401291|gb|ACX37122.1| (ORF1 [Pisum sativum])
BLAST of Medtr0029s0060.1 vs. NCBI nr
Match: gi|34761727|gb|AAQ82036.1| (unknown [Pisum sativum])
BLAST of Medtr0029s0060.1 vs. NCBI nr
Match: gi|34761723|gb|AAQ82034.1| (unknown [Pisum sativum])
BLAST of Medtr0029s0060.1 vs. NCBI nr
Match: gi|34761717|gb|AAQ82030.1| (unknown [Pisum sativum])
BLAST of Medtr0029s0060.1 vs. NCBI nr
Match: gi|34761720|gb|AAQ82032.1| (unknown [Pisum sativum])
BLAST of Medtr0029s0060.1 vs. NCBI nr
Match: gi|502127705|ref|XP_004499805.1| (PREDICTED: uncharacterized protein LOC101503074 [Cicer arietinum])
BLAST of Medtr0029s0060.1 vs. NCBI nr
Match: gi|502101963|ref|XP_004491925.1| (PREDICTED: uncharacterized protein LOC101494239 [Cicer arietinum] >gi|502158366|ref|XP_004511123.1| PREDICTED: uncharacterized protein LOC101500169 [Cicer arietinum])
BLAST of Medtr0029s0060.1 vs. NCBI nr
Match: gi|502178833|ref|XP_004516329.1| (PREDICTED: uncharacterized protein LOC101495653 [Cicer arietinum])
BLAST of Medtr0029s0060.1 vs. NCBI nr
Match: gi|502100826|ref|XP_004491752.1| (PREDICTED: uncharacterized protein LOC101511401 [Cicer arietinum])
BLAST of Medtr0029s0060.1 vs. NCBI nr
Match: gi|502167158|ref|XP_004514068.1| (PREDICTED: uncharacterized protein LOC101494877 [Cicer arietinum])
The following BLAST results are available for this feature:
BLAST of Medtr0029s0060.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|260401291|gb|ACX37122.1|1.135830e-8244.90ORF1 [Pisum sativum][more]
gi|34761727|gb|AAQ82036.1|7.494910e-8036.11unknown [Pisum sativum][more]
gi|34761723|gb|AAQ82034.1|4.672850e-7839.32unknown [Pisum sativum][more]
gi|34761717|gb|AAQ82030.1|8.298000e-7739.06unknown [Pisum sativum][more]
gi|34761720|gb|AAQ82032.1|1.718430e-7538.80unknown [Pisum sativum][more]
gi|502127705|ref|XP_004499805.1|2.086650e-6734.68PREDICTED: uncharacterized protein LOC101503074 [C... [more]
gi|502101963|ref|XP_004491925.1|4.412370e-6236.54PREDICTED: uncharacterized protein LOC101494239 [C... [more]
gi|502178833|ref|XP_004516329.1|9.901580e-6235.29PREDICTED: uncharacterized protein LOC101495653 [C... [more]
gi|502100826|ref|XP_004491752.1|4.193250e-6035.00PREDICTED: uncharacterized protein LOC101511401 [C... [more]
gi|502167158|ref|XP_004514068.1|6.358180e-5935.86PREDICTED: uncharacterized protein LOC101494877 [C... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableCOILcoilcoiled-coilcoord: 414..442
score
NoneNo IPR availableSEGsegsegcoord: 370..385
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0029s0060.1 ID=Medtr0029s0060.1|Name=Medtr0029s0060.1|organism=Medicago truncatula|type=mRNA|length=1416bp
ATGGAAAGAAGAAATACTAGGAAGTTTACATTCAGGAAATTGGATCTAGA
GAATTTAAAGAAGCTTGCATTTGAAGTAACTAGCTTGGAGAACTTTTGTG
ATCGTCATGGGAATTTGCTTGGTGTCCTCTGGACAAATATCGATAAGGGG
TGCTTGGAAACTTTGGTCCAGTTCTATGACCCTGCTTACCACTGTTTCAC
CTTTCCCGACTACCAGCTTATGCCTACCCTCGAAGAATACTCCCACTTAA
TTGGCCTACCCGTACTTGATAAGGTACCTTTTACTGGCTTAGAACCCTTT
CCCAAAGCTGCCACTATTGCAAACGCCCTCCATCTCAAAACCTCTCTCAT
AAAAGAAAAACTCACCCTAAAAGGGAATCTCCCAAGCTTACCTACTAAAT
TTCTTTACCAACAAGCCTCCGATTTCTCCAAAACAAACAATGTTGATGCC
TTTTACTCTATCCTAGCTTTACTCATCTATGGCCTAGTATTGTTCCCAAA
TATTGATAACTATGTTGACATCCATGCCATTCAAATTTTCCTCACAAAGA
ACCCAGTCCCCACATTGTTAGCTGATATATATCATTCCATTCACGATCGA
ACCCAAGTAGGTCGTGGAGCTATCCTCGGTTGCGCACCTTTACTATACAA
ATGGTTTGCCTCCCACTTACCTCAGACTCATTCCTTTCAAGCCAACCCAG
AAAATCTCTCCTGGCCCAAAAGAATCATGTCCCTTACCCCATCCGACATA
ACTTGGTACCGTGCTACTTGTAACTTCACGAACATCATTGTCAGTTGTGG
AGAATACTCAAATGTACCCCTTCTCGGTACGCAAGGAGGAATCAGCTACA
ATCCTATCCTTGCCAAACGTCAGTTCGGATGTCCAATGGAAGCTAAGCCA
GATAACATCTACCTACAAGGTGAATTCTACTTCAACCATGAAGATCCCTC
AAACAAAAGAGGGAGATTTGTCCAAGCATGGCATGCCATTCGCACACTCA
ATAGAAGCCAATTGGCGAGGAGATCAGACTCTTTACAGGGGTCTTACACG
CAATGGGTCATCAATAGAGCTTCCGATCTGGTCTTATCATATCATTTGCC
GAGGTACCTATCTTCAACAACCCCAGCGCCGGCTTTACCCTTGGCCCCCG
CAACTGTGGAGGAATGTCAAGAGAAGTTGGCCCGATCGGAATGTGTGGGT
GCTACCTGGAAAAGGAAGTATGATGAAGTTATGCTCAAGATGGAAACTAT
GAGTGGTGAGATAGAGCAACGAGAGCATGAGGTTCACAAGTTGAGACGAC
AAATAGTAAAAAAGAATGTTCAGATCCGAGCTCAGAGCACAAGGCTATCA
CGATTTATCAGCGCAGGGGAGCGCTGGGAGTTCTTCAAGGATGCACATTC
AGATTCTGATGAATAG
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated