Overview
NameMedtr0029s0040.1
Unique NameMedtr0029s0040.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length336
Homology
BLAST of Medtr0029s0040.1 vs. NCBI nr
Match: gi|356557909|ref|XP_003547252.1| (PREDICTED: putative ribonuclease H protein At1g65750-like [Glycine max])
BLAST of Medtr0029s0040.1 vs. NCBI nr
Match: gi|470138805|ref|XP_004305144.1| (PREDICTED: putative ribonuclease H protein At1g65750-like [Fragaria vesca subsp. vesca])
BLAST of Medtr0029s0040.1 vs. NCBI nr
Match: gi|470138356|ref|XP_004304923.1| (PREDICTED: putative ribonuclease H protein At1g65750-like [Fragaria vesca subsp. vesca])
BLAST of Medtr0029s0040.1 vs. NCBI nr
Match: gi|470105829|ref|XP_004289281.1| (PREDICTED: putative ribonuclease H protein At1g65750-like [Fragaria vesca subsp. vesca])
BLAST of Medtr0029s0040.1 vs. NCBI nr
Match: gi|470145456|ref|XP_004308354.1| (PREDICTED: putative ribonuclease H protein At1g65750-like [Fragaria vesca subsp. vesca])
BLAST of Medtr0029s0040.1 vs. NCBI nr
Match: gi|470145168|ref|XP_004308214.1| (PREDICTED: putative ribonuclease H protein At1g65750-like [Fragaria vesca subsp. vesca])
BLAST of Medtr0029s0040.1 vs. NCBI nr
Match: gi|470147813|ref|XP_004309472.1| (PREDICTED: putative ribonuclease H protein At1g65750-like [Fragaria vesca subsp. vesca])
BLAST of Medtr0029s0040.1 vs. NCBI nr
Match: gi|470112056|ref|XP_004292254.1| (PREDICTED: putative ribonuclease H protein At1g65750-like [Fragaria vesca subsp. vesca])
BLAST of Medtr0029s0040.1 vs. NCBI nr
Match: gi|470138965|ref|XP_004305222.1| (PREDICTED: putative ribonuclease H protein At1g65750-like [Fragaria vesca subsp. vesca])
BLAST of Medtr0029s0040.1 vs. NCBI nr
Match: gi|470148862|ref|XP_004309966.1| (PREDICTED: putative ribonuclease H protein At1g65750-like [Fragaria vesca subsp. vesca])
The following BLAST results are available for this feature:
BLAST of Medtr0029s0040.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|356557909|ref|XP_003547252.1|9.286830e-1233.33PREDICTED: putative ribonuclease H protein At1g657... [more]
gi|470138805|ref|XP_004305144.1|4.779330e-1140.85PREDICTED: putative ribonuclease H protein At1g657... [more]
gi|470138356|ref|XP_004304923.1|2.584990e-1040.85PREDICTED: putative ribonuclease H protein At1g657... [more]
gi|470105829|ref|XP_004289281.1|2.646120e-1039.44PREDICTED: putative ribonuclease H protein At1g657... [more]
gi|470145456|ref|XP_004308354.1|1.594000e-940.85PREDICTED: putative ribonuclease H protein At1g657... [more]
gi|470145168|ref|XP_004308214.1|2.504110e-933.05PREDICTED: putative ribonuclease H protein At1g657... [more]
gi|470147813|ref|XP_004309472.1|5.163040e-935.04PREDICTED: putative ribonuclease H protein At1g657... [more]
gi|470112056|ref|XP_004292254.1|1.177570e-848.39PREDICTED: putative ribonuclease H protein At1g657... [more]
gi|470138965|ref|XP_004305222.1|1.368710e-728.71PREDICTED: putative ribonuclease H protein At1g657... [more]
gi|470148862|ref|XP_004309966.1|3.683950e-745.16PREDICTED: putative ribonuclease H protein At1g657... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
BlastP Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0029s0040.1 ID=Medtr0029s0040.1|Name=Medtr0029s0040.1|organism=Medicago truncatula|type=mRNA|length=336bp
ATGAAATCAACAATAACGCATATTATAGCAAATGTATCTAGAGTTGGCAA
CCTTACCAAGTTAGCTACTGGTTCTGCAATTAGAGATTTCACTGTGTTAA
AGTCATATGGATCCCCCCCCCCCCAAATATTGCACTGGATCACGTGCAAC
AATGATGGAGCAGCTCTTGGCACCATCGGTCAAGCAGCTTGTGCAGGTAT
TTTCAGAAACCGAAATGAAGAAAGCCTTGGCTGTTTTGCAGTTAATTTAG
GGATTGAAAATGCTTTTTATGCTGAGCTCATGGGAGTGATTTTTGTTGTT
GAATGTGCTATTCAGAAAAGATGGACTCATATCTAG
back to top