Overview
NameMedtr0028s0290.1
Unique NameMedtr0028s0290.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length930
Homology
BLAST of Medtr0028s0290.1 vs. NCBI nr
Match: gi|502166128|ref|XP_004513798.1| (PREDICTED: uncharacterized protein LOC101507481 [Cicer arietinum])
BLAST of Medtr0028s0290.1 vs. NCBI nr
Match: gi|502177137|ref|XP_004516016.1| (PREDICTED: uncharacterized protein LOC101507391 [Cicer arietinum])
BLAST of Medtr0028s0290.1 vs. NCBI nr
Match: gi|502158409|ref|XP_004511140.1| (PREDICTED: uncharacterized protein LOC101507149 [Cicer arietinum])
BLAST of Medtr0028s0290.1 vs. NCBI nr
Match: gi|502164606|ref|XP_004513178.1| (PREDICTED: uncharacterized protein LOC101508308 [Cicer arietinum])
BLAST of Medtr0028s0290.1 vs. NCBI nr
Match: gi|502174951|ref|XP_004515638.1| (PREDICTED: uncharacterized protein LOC101507902 [Cicer arietinum])
BLAST of Medtr0028s0290.1 vs. NCBI nr
Match: gi|502147400|ref|XP_004506768.1| (PREDICTED: uncharacterized protein LOC101514612 [Cicer arietinum])
BLAST of Medtr0028s0290.1 vs. NCBI nr
Match: gi|502093969|ref|XP_004490107.1| (PREDICTED: uncharacterized protein LOC101511498 [Cicer arietinum])
BLAST of Medtr0028s0290.1 vs. NCBI nr
Match: gi|502122613|ref|XP_004497831.1| (PREDICTED: uncharacterized protein LOC101491671 [Cicer arietinum])
BLAST of Medtr0028s0290.1 vs. NCBI nr
Match: gi|502129824|ref|XP_004500437.1| (PREDICTED: uncharacterized protein LOC101500968 [Cicer arietinum])
BLAST of Medtr0028s0290.1 vs. NCBI nr
Match: gi|502129821|ref|XP_004500436.1| (PREDICTED: uncharacterized protein LOC101500655 [Cicer arietinum])
The following BLAST results are available for this feature:
BLAST of Medtr0028s0290.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502166128|ref|XP_004513798.1|2.668590e-1028.66PREDICTED: uncharacterized protein LOC101507481 [C... [more]
gi|502177137|ref|XP_004516016.1|5.725650e-1027.78PREDICTED: uncharacterized protein LOC101507391 [C... [more]
gi|502158409|ref|XP_004511140.1|6.301240e-1031.06PREDICTED: uncharacterized protein LOC101507149 [C... [more]
gi|502164606|ref|XP_004513178.1|7.474150e-926.67PREDICTED: uncharacterized protein LOC101508308 [C... [more]
gi|502174951|ref|XP_004515638.1|1.600020e-826.06PREDICTED: uncharacterized protein LOC101507902 [C... [more]
gi|502147400|ref|XP_004506768.1|5.056310e-826.06PREDICTED: uncharacterized protein LOC101514612 [C... [more]
gi|502093969|ref|XP_004490107.1|6.864000e-824.68PREDICTED: uncharacterized protein LOC101511498 [C... [more]
gi|502122613|ref|XP_004497831.1|8.699980e-828.57PREDICTED: uncharacterized protein LOC101491671 [C... [more]
gi|502129824|ref|XP_004500437.1|1.002650e-722.75PREDICTED: uncharacterized protein LOC101500968 [C... [more]
gi|502129821|ref|XP_004500436.1|1.489910e-724.85PREDICTED: uncharacterized protein LOC101500655 [C... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableSEGsegsegcoord: 204..212
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0028s0290.1 ID=Medtr0028s0290.1|Name=Medtr0028s0290.1|organism=Medicago truncatula|type=mRNA|length=930bp
ATGGAAGAATCAAAACAAACCTTCTCTGAACTCCTCTCCTCTATCGGTCA
ACAAAACCTACCTTCAGCAAAGCATTCACCCCCACAAACTCCTCCTGCTG
CATTTACATATTCTGCACAAAACATCACTACTACCTCAAGTCTAAATCTT
CTCTCAAAAATCGAACCTTACTATTGCTCCCCTTCTAAAATCTCTTACAT
TGACCTTGAGAATGAATCTGAGACCTTTATACAAGCTCAAAACCCAGCCA
AACGACTCAAACAATACTCATTAGCTTTTTCACCATACGATCGCAAGGAA
GCTAAGAAGGAAAAAATGCTGGAAGATATCGTCTCTAAATCTGTTAACAT
TAAGGAAAAACTAATCTTGAATCCATACCTAACAAACCCAGCACCTGAAA
TTCCTTCAAGACCTCTCTGTGAAAGCAAATCTTTTGATTTCGAGGATATG
AAGAGTAAGAGCATTGTACTCGATGTTGTAATGACAAGTATTGGTTGGAA
AGAATTTTGTGAGTTAGATCAGTTAATTTATCCAAACCTAGTTCAACAAT
CCTACTCATCCCCTAGGGTACTCGAAGGACACGATGTGATCCTCTGTTTT
ATGAATCAAACTGATATCATCATAACCACTGACATCCTTTATGACAAGGT
TGAATCTAACAGGAACTCTGTTATAAAAGAATTTTTCGGTGATGTTAAGC
CAGCCAAAGACTTTCCTGTAACTGCTTTGAAGAATGAGTACAAGATTCTT
CATAATCTATGTACTCACAGTCTGTTACCACGCAGCAGCAGCAGGTATCG
AGTTAATGATTTTGATCTTATGATCTTGTATCACTTAACTCGTGGAAAGA
GGGTTATTGCTATTCAAGGTTTGGTGTTTGTTTGCTCTTCATTACCAGCC
TCAAATCACCGCAATTTTAAAGATAGATAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated