Overview
NameMedtr0028s0210.1
Unique NameMedtr0028s0210.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length390
Homology
BLAST of Medtr0028s0210.1 vs. NCBI nr
Match: gi|343475304|emb|CCD13270.1| (unnamed protein product [Trypanosoma congolense IL3000])
BLAST of Medtr0028s0210.1 vs. NCBI nr
Match: gi|156549332|ref|XP_001601102.1| (PREDICTED: protein transport protein Sec24C-like [Nasonia vitripennis] >gi|645014272|ref|XP_008203409.1| PREDICTED: protein transport protein Sec24C-like [Nasonia vitripennis] >gi|645014274|ref|XP_008203410.1| PREDICTED: protein transport protein Sec24C-like [Nasonia vitripennis] >gi|645014276|ref|XP_008203411.1| PREDICTED: protein transport protein Sec24C-like [Nasonia vitripennis] >gi|645014278|ref|XP_008203412.1| PREDICTED: protein transport protein Sec24C-like [Nasonia vitripennis] >gi|645014280|ref|XP_008203413.1| PREDICTED: protein transport protein Sec24C-like [Nasonia vitripennis])
BLAST of Medtr0028s0210.1 vs. NCBI nr
Match: gi|149391787|emb|CAO00730.1| (putative cellulosomal scaffoldin protein precursor [Ruminococcus flavefaciens])
BLAST of Medtr0028s0210.1 vs. NCBI nr
Match: gi|70932549|ref|XP_737779.1| (cyclin related protein [Plasmodium chabaudi chabaudi] >gi|56513449|emb|CAH82122.1| cyclin related protein, putative [Plasmodium chabaudi chabaudi])
BLAST of Medtr0028s0210.1 vs. NCBI nr
Match: gi|326666380|ref|XP_003198256.1| (PREDICTED: hypothetical protein LOC100537740 [Danio rerio])
BLAST of Medtr0028s0210.1 vs. NCBI nr
Match: gi|225641|prf||1308219B (ORF 2)
BLAST of Medtr0028s0210.1 vs. NCBI nr
Match: gi|291234682|ref|XP_002737279.1| (PREDICTED: salivary glue protein Sgs-3-like [Saccoglossus kowalevskii])
BLAST of Medtr0028s0210.1 vs. NCBI nr
Match: gi|71423030|ref|XP_812319.1| (hypothetical protein [Trypanosoma cruzi strain CL Brener] >gi|70877088|gb|EAN90468.1| hypothetical protein, conserved [Trypanosoma cruzi])
The following BLAST results are available for this feature:
BLAST of Medtr0028s0210.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 8
Match NameE-valueIdentityDescription
gi|343475304|emb|CCD13270.1|2.944310e-732.05unnamed protein product [Trypanosoma congolense IL... [more]
gi|156549332|ref|XP_001601102.1|3.994200e-739.76PREDICTED: protein transport protein Sec24C-like [... [more]
gi|149391787|emb|CAO00730.1|2.075650e-633.33putative cellulosomal scaffoldin protein precursor... [more]
gi|70932549|ref|XP_737779.1|1.512800e-536.56cyclin related protein [Plasmodium chabaudi chabau... [more]
gi|326666380|ref|XP_003198256.1|2.553800e-536.99PREDICTED: hypothetical protein LOC100537740 [Dani... [more]
gi|225641|prf||1308219B5.251400e-529.57ORF 2[more]
gi|291234682|ref|XP_002737279.1|6.033600e-424.71PREDICTED: salivary glue protein Sgs-3-like [Sacco... [more]
gi|71423030|ref|XP_812319.1|8.439060e-434.21hypothetical protein [Trypanosoma cruzi strain CL ... [more]
back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableSEGsegsegcoord: 109..128
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0028s0210.1 ID=Medtr0028s0210.1|Name=Medtr0028s0210.1|organism=Medicago truncatula|type=mRNA|length=390bp
ATGGTTTGGCATCAACAACAACTTCAACGATTCGTTGACGACAACATCAA
TATGACAATACAATACATGAGAGTTCACCACCTCCTACAAATACGACAAC
GTAAGAGTACACCACCTTTCGCAAAACAACAACATAAGAGTACACCACCT
CTAATAAAACGACAACATAAGAGTACACCGCCTTTCGCAAAACAACAACA
TAAGAGTACATCACCTCTTATAAAACGACAACATAAGAGTACACCACCTC
TTATAAAACAACAACATAACAGTACACCACCTCTTATAAAACGACAACAT
AAGAGTACACCACCTCTTACAAAACAACAACATACAACTCAACAACACTT
ACATCAACTTATAACTCAACGGCGTCAACAACAAGGATGA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated