Overview
NameMedtr0028s0170.1
Unique NameMedtr0028s0170.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1605
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0048856 anatomical structure development
biological_process GO:0008150 biological_process
biological_process GO:0032502 developmental process
biological_process GO:0007275 multicellular organismal development
biological_process GO:0032501 multicellular organismal process
biological_process GO:0043581 mycelium development
biological_process GO:0006468 protein phosphorylation
biological_process GO:0044707 single-multicellular organism process
biological_process GO:0044767 single-organism developmental process
biological_process GO:0044699 single-organism process
cellular_component GO:0005623 cell
cellular_component GO:0005575 cellular_component
molecular_function GO:0005524 ATP binding
molecular_function GO:0005509 calcium ion binding
molecular_function GO:0005085 guanyl-nucleotide exchange factor activity
molecular_function GO:0003674 molecular_function
molecular_function GO:0004672 protein kinase activity
molecular_function GO:0004674 protein serine/threonine kinase activity
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00036.2775261-75181384-4102-2829.51.8e-10107.92e-32
PF00069.2076179-7540378-3361-260234.48.5e-73236.62.2e-70
PF06293.975957-75739152-22492-16521.56.9e-0822.83.6e-05
PF07714.1276173-7542480-3293-254105.41.9e-33106.11.4e-30
PF13202.175261-75187384-4081-2419.53.1e-0772.75.8e-21
PF13405.175261-75184384-4092-2722.93.5e-0884.28.5e-25
PF13499.175261-75082384-4432-6554.19.4e-1895.31.6e-27
PF13833.175258-75181385-41028-5317.81.3e-0677.14.9e-22

Homology
BLAST of Medtr0028s0170.1 vs. NCBI nr
Match: gi|502164718|ref|XP_004513232.1| (PREDICTED: calcium-dependent protein kinase 17-like [Cicer arietinum])
BLAST of Medtr0028s0170.1 vs. NCBI nr
Match: gi|356519870|ref|XP_003528592.1| (PREDICTED: calcium-dependent protein kinase 17-like [Glycine max])
BLAST of Medtr0028s0170.1 vs. NCBI nr
Match: gi|356577343|ref|XP_003556786.1| (PREDICTED: calcium-dependent protein kinase 17-like [Glycine max])
BLAST of Medtr0028s0170.1 vs. NCBI nr
Match: gi|449444861|ref|XP_004140192.1| (PREDICTED: calcium-dependent protein kinase 17-like [Cucumis sativus] >gi|449480989|ref|XP_004156049.1| PREDICTED: calcium-dependent protein kinase 17-like [Cucumis sativus])
BLAST of Medtr0028s0170.1 vs. NCBI nr
Match: gi|502098424|ref|XP_004491231.1| (PREDICTED: calcium-dependent protein kinase 17-like [Cicer arietinum])
BLAST of Medtr0028s0170.1 vs. NCBI nr
Match: gi|359479312|ref|XP_002276630.2| (PREDICTED: calcium-dependent protein kinase 17-like [Vitis vinifera])
BLAST of Medtr0028s0170.1 vs. NCBI nr
Match: gi|590584710|ref|XP_007015253.1| (Calcium-dependent protein kinase 17 [Theobroma cacao] >gi|508785616|gb|EOY32872.1| Calcium-dependent protein kinase 17 [Theobroma cacao])
BLAST of Medtr0028s0170.1 vs. NCBI nr
Match: gi|255570203|ref|XP_002526062.1| (calcium-dependent protein kinase, putative [Ricinus communis] >gi|223534643|gb|EEF36339.1| calcium-dependent protein kinase, putative [Ricinus communis])
BLAST of Medtr0028s0170.1 vs. NCBI nr
Match: gi|356499303|ref|XP_003518481.1| (PREDICTED: calcium-dependent protein kinase 17-like [Glycine max])
BLAST of Medtr0028s0170.1 vs. NCBI nr
Match: gi|147777348|emb|CAN62888.1| (hypothetical protein VITISV_025544 [Vitis vinifera])
The following BLAST results are available for this feature:
BLAST of Medtr0028s0170.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502164718|ref|XP_004513232.1|0.000000e+092.95PREDICTED: calcium-dependent protein kinase 17-lik... [more]
gi|356519870|ref|XP_003528592.1|0.000000e+088.10PREDICTED: calcium-dependent protein kinase 17-lik... [more]
gi|356577343|ref|XP_003556786.1|0.000000e+088.17PREDICTED: calcium-dependent protein kinase 17-lik... [more]
gi|449444861|ref|XP_004140192.1|0.000000e+083.61PREDICTED: calcium-dependent protein kinase 17-lik... [more]
gi|502098424|ref|XP_004491231.1|0.000000e+084.72PREDICTED: calcium-dependent protein kinase 17-lik... [more]
gi|359479312|ref|XP_002276630.2|0.000000e+083.18PREDICTED: calcium-dependent protein kinase 17-lik... [more]
gi|590584710|ref|XP_007015253.1|0.000000e+082.68Calcium-dependent protein kinase 17 [Theobroma cac... [more]
gi|255570203|ref|XP_002526062.1|0.000000e+082.28calcium-dependent protein kinase, putative [Ricinu... [more]
gi|356499303|ref|XP_003518481.1|0.000000e+082.00PREDICTED: calcium-dependent protein kinase 17-lik... [more]
gi|147777348|emb|CAN62888.1|0.000000e+082.08hypothetical protein VITISV_025544 [Vitis vinifera... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR000719Protein kinase, catalytic domainPROFILEPS50011PROTEIN_KINASE_DOMcoord: 78..336
score: 47
IPR002048Calcium-binding EF-handSMARTSM00054no descriptioncoord: 383..411
score: 2.4e-05coord: 419..447
score: 1.6e-05coord: 455..483
score: 0.043coord: 490..518
score: 1
IPR002290Serine/threonine-protein kinase domainSMARTSM00220no descriptioncoord: 78..336
score: 1.5
IPR008271Serine/threonine-protein kinase, active sitePROSITEPS00108PROTEIN_KINASE_STcoord: 198..210
score
IPR011009Protein kinase-like domainSUPERFAMILY56112Protein kinase-like (PK-like)coord: 53..363
score: 3.8
IPR011992EF-hand-like domainGENE3D1.10.238.10no descriptioncoord: 365..518
score: 5
IPR017441Protein kinase, ATP binding sitePROSITEPS00107PROTEIN_KINASE_ATPcoord: 84..111
score
IPR018247EF-Hand 1, calcium-binding sitePROSITEPS00018EF_HAND_1coord: 392..404
score: NAcoord: 428..440
score: NAcoord: 464..476
score: NAcoord: 499..511
score
IPR018249EF-HAND 2PROFILEPS50222EF_HAND_2coord: 379..414
score: 14.374coord: 415..450
score: 13.258coord: 451..486
score: 14.151coord: 490..521
score: 12
IPR020635Tyrosine-protein kinase, catalytic domainSMARTSM00219no descriptioncoord: 78..336
score: 8.4
NoneNo IPR availableGENE3D1.10.510.10no descriptioncoord: 175..364
score: 2.5
NoneNo IPR availableGENE3D3.30.200.20no descriptioncoord: 63..174
score: 3.3
NoneNo IPR availableSEGsegsegcoord: 32..62
score
NoneNo IPR availableSUPERFAMILY47473EF-handcoord: 363..515
score: 1.4

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0028s0170.1 ID=Medtr0028s0170.1|Name=Medtr0028s0170.1|organism=Medicago truncatula|type=mRNA|length=1605bp
ATGGGAAATTGTTGCTCCCAAGGCGGTGATACCCCGGCCGACAATCCGGC
CGTGGCCGACAAGGGAGAAACCAACACCAACCAGGATAATGAGCCATCAA
CGAACCCTATCACGACGCCACCACCAACATCAAAACCACCACAATCAACG
GCACCTCCTTCATCAAAACCCTCGAAACCGGCTGCAGTTGGTCCCGTATT
ACAACGACCAATGGAAGACGTTCGAGCCACATATTCCATAGGGAAAGAGC
TAGGGAGAGGACAATTTGGGGTAACACATTTATGTACACATAAGGTAACA
AAAGAACAATTTGCATGCAAAACGATTGCCAAGAGAAAACTAGTGAATAA
AGAGGATATAGAGGATGTTAGAAGGGAAGTGCAAATAATGCATCACCTAA
CGGGCCAAGCAAACATTGTGGAATTGAAAGGCGCATATGAAGACAAACAA
TCGGTTCATTTGGTCATGGAATTATGTGCCGGTGGTGAACTATTTGATCG
AATTATTGCAAAGGGACATTATACCGAACGTGCCGCAGCTTCTTTGATGA
GAACCATTGTGCAAATTATTCATACTTTGCATTCAATGGGTGTTATTCAT
AGAGATCTTAAGCCAGAAAATTTCCTCTTGTTGAATAAGGATGAAAATGC
ACCTCTTAAGGCCACCGATTTTGGTCTATCCGTCTTTTTCAAAGAAGGAG
AGATGTTCAAAGACATTGTTGGCAGTGCATATTACATAGCACCAGAGGTG
TTGAAGAGAAGATATGGGCCTGAAGTTGATATTTGGAGTATTGGTGTCAT
GCTATACATTCTTCTTTCTGGTGTCCCTCCTTTTTGGGCAGAATCTGAAC
ATGGTATATTCAATGCCATCTTAAGAGGCCACATTGACTTTACAAGCGAT
CCATGGCCTTCAATTTCACCTGCAGCAAAAGATCTTGTAAGGAAAATGTT
AAATTCAGATCCCAAACAAAGACTTACAGCCTTTGAAGTTTTGAATCACC
CGTGGATCAAGGAGGACGGTGAAGCACCAGATAAACCTATTGACAATGCT
GTACTAAATAGGCTCAAGCAGTTCAGAGCAATGAACCAATTTAAGAAAGT
TGCTCTAAGGGTAATTGCTGGATGTTTATCGGAAGAAGAAATAATGGGGT
TGAAGGAAATGTTCAAGGGGATGGACACTGACAACAGTGGAACCATTACA
GTTGAAGAACTCAAACAAGGACTTGCAAAGCAGGGCACCAAGCTTTCAGA
ACAAGAAGTTAAGCAATTAATGGACGCTGCGGATGCGGATGGCAATGGAA
CAATAGATTACGACGAGTTCATCACAGCAACAATGCACATGAACAGAATG
AATAGAGAAGAACATCTTTACACTGCCTTCCAATACTTTGATAAAGATAA
CAGCGGGTTCATTACCACTGAAGAACTAGATCAAGCTCTCCGTGAATACA
ACATGCATGATGGCAGAGACATCAAAGAGATACTTCAAGAAGTTGATGGA
GATAATGATGGACGTATTAACTATGATGAATTTGCTGCAATGATGAGAAA
AGGAAATCCGGAAGCTCATACTAAGAAGAGGCGTGATTCATTTGTTTCAC
ATTAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR000719Protein kinase, catalytic domain
IPR002048Calcium-binding EF-hand
IPR002290Serine/threonine-protein kinase domain
IPR008271Serine/threonine-protein kinase, active site
IPR011009Protein kinase-like domain
IPR011992EF-hand-like domain
IPR017441Protein kinase, ATP binding site
IPR018247EF-Hand 1, calcium-binding site
IPR018249EF-HAND 2
IPR020635Tyrosine-protein kinase, catalytic domain
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0004672protein kinase activity
GO:0005524ATP binding
GO:0005509calcium ion binding
GO:0004674protein serine/threonine kinase activity
GO:0003674molecular_function
GO:0005085guanyl-nucleotide exchange factor activity
Vocabulary: Biological Process
TermDefinition
GO:0006468protein phosphorylation
GO:0007275multicellular organismal development
GO:0008150biological_process
GO:0032501multicellular organismal process
GO:0032502developmental process
GO:0043581mycelium development
GO:0044699single-organism process
GO:0044707single-multicellular organism process
GO:0044767single-organism developmental process
GO:0048856anatomical structure development
Vocabulary: Cellular Component
TermDefinition
GO:0005575cellular_component
GO:0005623cell