Overview
NameMedtr0028s0090.1
Unique NameMedtr0028s0090.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1299
Homology
BLAST of Medtr0028s0090.1 vs. NCBI nr
Match: gi|502128756|ref|XP_004500069.1| (PREDICTED: crt homolog 1-like [Cicer arietinum])
BLAST of Medtr0028s0090.1 vs. NCBI nr
Match: gi|356519872|ref|XP_003528593.1| (PREDICTED: crt homolog 1-like [Glycine max])
BLAST of Medtr0028s0090.1 vs. NCBI nr
Match: gi|356577341|ref|XP_003556785.1| (PREDICTED: crt homolog 1-like [Glycine max])
BLAST of Medtr0028s0090.1 vs. NCBI nr
Match: gi|359479254|ref|XP_002276436.2| (PREDICTED: crt homolog 1-like [Vitis vinifera])
BLAST of Medtr0028s0090.1 vs. NCBI nr
Match: gi|296083866|emb|CBI24254.3| (unnamed protein product [Vitis vinifera])
BLAST of Medtr0028s0090.1 vs. NCBI nr
Match: gi|502098412|ref|XP_004491229.1| (PREDICTED: crt homolog 3-like isoform X1 [Cicer arietinum])
BLAST of Medtr0028s0090.1 vs. NCBI nr
Match: gi|449444865|ref|XP_004140194.1| (PREDICTED: crt homolog 2-like [Cucumis sativus] >gi|449480984|ref|XP_004156047.1| PREDICTED: crt homolog 2-like [Cucumis sativus])
BLAST of Medtr0028s0090.1 vs. NCBI nr
Match: gi|356553645|ref|XP_003545164.1| (PREDICTED: crt homolog 1-like [Glycine max])
BLAST of Medtr0028s0090.1 vs. NCBI nr
Match: gi|224103963|ref|XP_002313263.1| (predicted protein [Populus trichocarpa])
BLAST of Medtr0028s0090.1 vs. NCBI nr
Match: gi|460415071|ref|XP_004252884.1| (PREDICTED: crt homolog 3-like [Solanum lycopersicum])
The following BLAST results are available for this feature:
BLAST of Medtr0028s0090.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502128756|ref|XP_004500069.1|0.000000e+083.37PREDICTED: crt homolog 1-like [Cicer arietinum][more]
gi|356519872|ref|XP_003528593.1|0.000000e+074.65PREDICTED: crt homolog 1-like [Glycine max][more]
gi|356577341|ref|XP_003556785.1|0.000000e+075.34PREDICTED: crt homolog 1-like [Glycine max][more]
gi|359479254|ref|XP_002276436.2|0.000000e+077.63PREDICTED: crt homolog 1-like [Vitis vinifera][more]
gi|296083866|emb|CBI24254.3|0.000000e+082.54unnamed protein product [Vitis vinifera][more]
gi|502098412|ref|XP_004491229.1|0.000000e+070.53PREDICTED: crt homolog 3-like isoform X1 [Cicer ar... [more]
gi|449444865|ref|XP_004140194.1|0.000000e+065.87PREDICTED: crt homolog 2-like [Cucumis sativus] >g... [more]
gi|356553645|ref|XP_003545164.1|1.932600e-18070.23PREDICTED: crt homolog 1-like [Glycine max][more]
gi|224103963|ref|XP_002313263.1|1.706310e-17879.44predicted protein [Populus trichocarpa][more]
gi|460415071|ref|XP_004252884.1|5.306850e-17768.30PREDICTED: crt homolog 3-like [Solanum lycopersicu... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableCOILcoilcoiled-coilcoord: 68..89
score
NoneNo IPR availableSEGsegsegcoord: 90..105
score: NAcoord: 165..186
score: NAcoord: 402..414
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0028s0090.1 ID=Medtr0028s0090.1|Name=Medtr0028s0090.1|organism=Medicago truncatula|type=mRNA|length=1299bp
ATGACGTCATTCTGCCGGCGGTCACCTACCGCCGGCACCGTCTCCCTCTA
CGGTCAAGTCCGCCTACTCCAACCAACAAACTCCACCGCCGGAATCCACT
ACGGCTATTCACCTCAACGCCAGGGAATCTCCGTTTTACAGCTACGGCGA
CGTACGTGGATTCCGGTGGTAGAAGCGAGTGGCGCAAGGGAGAGATCGGA
TGTCAGTGAGGAGGATGAGAAGAAGAGGATTGTGGAGGATAATTGTCGGA
AAAGTGAGAATCAGACGGTGAAGGTGGTGGTTGCTGCGGCGGCTGTTGGT
GTATTCGGTGTCGGAAATAGGGTGCTTTATAAGCTGGCGTTGGTTCCATT
GAAACAGTATCCATTCTTCTTGGCTCAGTTTTCAACTTTTGTATATGTAA
TTGTATACTTTTCTATTTTATATATCCGGTACCGTGCTGGCATTGTCACT
GATGAGATGTTAGCAGTGCCTAAAACTCCATTTCTGATTGTTGGTCTCTT
GGAAGCTCTAGGTGCTGCCACAGGAATGGCAGCAGGAGCAATGCTATCGG
GCGCATCAATTCCAATATTGTCTCAGACTTTTCTTGTGTGGCAAATTCTC
CTGTCAACTATATTTCTTGGGAGAAGATATAAGGTCAACCAACTACTTGG
ATGCTTTCTTGTGGCAATCGGTGTAATCATCACTGTAGCAAGTGGATCTG
GTGCCGGGAAATCATTGCAGGAAGCTGGTATATTTTGGAGTCTTTTAATG
ATGGTTTCATTTTTATTCCAAGCAGCCGATACTGTGCTCAAGGAGGTAAT
CTTTTCGGATGCAACCCAGAAACTAAAGGGAGGTTCTCTGGATTTGTTTG
TTGTCAATTCCTTTGGATCTGCTTTTCAAGCGCTGTTTATATGCCTCCTC
CTCCCTTTCTTATCAAAACTTTGGGGCATCCCTTTCAGTCAACTGCCAAA
CTACCTTAAAGATGGTGCAGCTTGCTTTCTGAATATTGGGAAGCTGTCTA
GCGGATGTGATGGAGCTCCCTTGCTGCCCTTGCTGTTTATTATTGTCAAC
ATGGGCTTCAATATCTCATTGCTTCATCTCCTCAAGATCTCTTCAGCTGT
TGTATCTTGTCTAGCCACCACTGTAGCAGTCCCAATATCAATCTATATGT
TCACGCTGCCACTGCCATACCTTGGTGTTGCCTCTTCCCTTCCAACAGGC
TTTCTTGCTGGAGCCATCATTCTCATCATGGGATTACTCATTTATACATG
GACTCCTCCAAATGTTTCCTCCAATGCTTCCATGACTGCACCCACGTAG
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated